Introduction
In commercial pig farming, increasing litter size is of great economic
interest as a means to increase production (Balcells et al., 2011; Nielsen et
al., 2013; Rutherford et al., 2013). Litter size is typically defined as the
total number of piglets born (TNB) or the number of piglets born alive (NBA).
Litter size is controlled by many factors, such as ovulation rate (number of
ovulated eggs), number of corpora lutea, fertilization rate, uterine
capacity, and prenatal survival (Distl, 2007; Mesa et al., 2003). Fetal
survival is primarily determined by the uterine capacity of the dam, which
can be defined in terms of the relative surface area of placental endometrial
attachment required to support the nutrient requirements of an individual
fetus throughout gestation (Wilson et al., 1998). Therefore, uterine traits
can greatly influence litter size. In addition, the low
heritability of litter size (5 %–10 %) suggests that proximate
environmental variables may contribute significantly to variation in it (Dube et al., 2012).
DNA methylation is among the main epigenetic mechanisms and plays
significant roles in gene silencing (Newell-Price et al.,
2000), tissue differentiation (Laurent et al., 2010), cellular
development (Smith and Meissner, 2013), X-chromosome inactivation
(Pollex and Heard, 2012), and genetic imprinting (Li
et al., 1993). Importantly, DNA methylation is both stably heritable and
fully reversible. DNA methylation may reflect interactions between genetic
and environmental factors in the development and reproduction of pigs. In
particular, when DNA methylation occurs in a gene promoter, it typically
acts to repress gene transcription. Several studies have suggested a
correlation between differentially methylated regions (DMRs) near promoter
regions and gene expression changes (Lister et al., 2009; Meissner et
al., 2008; Varley et al., 2013). Furthermore, these types of dynamic changes
in DNA methylation tend to occur during embryonic development as cells
differentiate or become reprogrammed (Hajkova et al., 2002; Mayer et al.,
2000; Sasaki and Matsui, 2008). Many recent studies have examined the
genome-wide methylation profiles of livestock phenotypes associated with
disease resistance, milk production, and reproduction (Congras et al.,
2014; Coster et al., 2012; Jin et al., 2014; Singh et al., 2012). DNA
methylation affects the expression of many genes that are critical to
reproductive traits (Calicchio et al., 2014; Messerschmidt et al., 2014;
Stevenson and Prendergast, 2013). Hwang et al. (2017) recently identified
DMRs and differentially expressed genes (DEGs) associated with litter size
in pig placentas and suggested that the PRKG2, CLCA4, and PCK1 genes play important roles
in improving litter size by increasing nutrition supply through the
placenta.
The objective of this study was to use epigenetic approaches to examine
uterine tissues of Berkshire pigs with smaller and larger litter sizes,
using genome-wide bisulfite sequencing (GWBS) technology. Our findings will
provide useful knowledge and a clearer understanding of the reproductive
phenotypes of individual pigs and could help in selecting sows with high
fecundity for breeding.
Comparison of average of TNB between SLG and LLG. The bars represent
the mean ± SD; n=3.
∗ Significantly different between both groups at p<0.05. TNB: total
number of piglets born; SLG: smaller litter size group; LLG: larger litter
size group.
![]()
Materials and methods
Animals and sample preparation
All animal experiments were approved by the Gyeongnam National University of
Science and Technology Institutional Animal Care and Use Committee (permit
no. 2105-5). All Berkshire sows used in this study were reared under the same
environmental conditions (Dasan Pig Breeding Co., Namwon, Korea) and provided
with the same commercial diet and water ad libitum. To analyze DNA
profiling according to litter size, animals were divided into smaller litter
size groups (SLGs; average litter size ≤7) and larger litter size groups
(LLGs; average litter size ≥10), and three sows were randomly selected
from each group (Fig. 1). The uterus was collected immediately after
slaughter and flushed with phosphate-buffered saline (PBS); the endometrium
was then separated from the uterus. The collected endometrium was rapidly
frozen in liquid nitrogen and stored at -80 ∘C until further
analysis. To verify the usefulness of the candidate gene as a prognostic
tool, whole blood samples were collected from 172 sows using BD Vacutainer
K2 EDTA tubes (BD, Oxford, UK) as an anticoagulant. Blood was mixed
immediately after the draw by inverting the tubes 10 times and then stored
at 2–8 ∘C until use.
DNA methylation
Genome-wide bisulfite sequencing for marker selection
Genomic DNA (gDNA) was isolated from three endometrium tissues per group
using a DNeasy Tissue Kit (Qiagen, Valencia, CA, USA) and pooled for GWBS
analyses. gDNA (≥6 µg) was fragmented by ultrasonication to
approximately 100–300 bps and then end-repaired, 3′-end
adenylated, and ligated with adapters. Fragmented DNA was bisulfite-converted
using the EZ DNA Methylation-Gold Kit (Zymo Research, Orange, CA, USA).
Bisulfite-converted DNA was quantified using a Quant-iT dsDNA High
Sensitivity Assay Kit (Life Technologies, Rockville, MD, USA) on an Agilent
2100 Bioanalyzer (Agilent Technologies, Inc., Santa Clara, CA, USA) and used
as a template for polymerase chain reaction (PCR) amplification. After
quantitative PCR (qPCR) amplification, the resulting libraries were subjected
to paired-end sequencing with a 100 bp read length using the Illumina HiSeq
2500 platform (Illumina, San Diego, CA, USA). The raw sequencing reads were
cleaned by removing adaptor sequences, and reads with a percentage of unknown
bases greater than 10 % and low-quality reads (more than
20 % of < Q20 bases) were filtered out to retain only high-quality
reads. Clean reads were then mapped to the pig reference genome (Sscrofa
10.2) using Bismark software (version 0.9.0) with two allowed mismatches
(Krueger and Andrews, 2011). Methylated cytosines were extracted from aligned
reads using the Bismark methylation extractor with standard parameters. The
methylation level of a cytosine (C) within an aligned read was determined by
calculating the ratio of the number of reads containing a methylated C at the
location to the number of all reads covering the location. DMRs between the
two groups were predicted using CpG_MP with the default parameters (length,
cytosine–guanine (CG) content, and cytosine : phosphate : guanine (CpG)
ratio) (Su et al., 2013). We identified differentially methylated genes
(DMGs) when a DMR and specific gene function element (e.g., a promoter)
overlapped in the University of California Santa Cruz Genome Browser
Database. Gene Ontology (GO) analysis was performed for gene functional
annotation using DAVID Bioinformatics Resources (version 6.7;
http://david.abcc.ncifcrf.gov/, last access: 13 April 2018).
Primer sequences used for PMP assay and RT-PCR.
Application
Gene
Accession no.
Primer (5′→3′)
Product size
PMP assay
ZPBP
NC_010451.3
F: TCAGGTGAGGCGTCGGCAT
162
R: CGTCATCAATGTCCAGTCCT
RT-PCR
ZPBP
NM_214106.1
F: CTGGATTAACCGCTGCTTTC
158
R: ATGCTTTTGCTCCAAACACC
PPIA
NM_214353.1
F: CACAAACGGTTCCCAGTTTT
171
R: TGTCCACAGTCAGCAATGGT
F: forward; R: reverse.
Porcine methylation-specific restriction enzyme PCR assay
The Porcine methylation-specific restriction enzyme PCR (PMP) assay is a
PCR-based methylation method that uses methylation-sensitive restriction
enzymes to determine DNA methylation status. To verify the result of GWBS,
whole blood samples were collected from Berkshire sows to isolate gDNA using
a Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) according
to the manufacturer's instructions and digested with HpaII (NEB,
Hitchin, UK) and MspI (NEB), a pair of methylation-sensitive
isoschizomers that have the same recognition site (CC|GG). An undigested gDNA
(5 µg) served as the negative control. Gene-specific primers were
designed to flank the HpaII/MspI sites; these are described
in Table 1. PCR was performed under the following conditions: 94 ∘C
for 5 min, followed by 35 cycles of 94 ∘C for 30 s, 60 ∘C
for 30 s, and 72 ∘C for 30 s. The products were electrophoresed on
a 2 % (w/v) agarose gel in 6X loading buffer (Biosesang, Seongnam,
Korea).
Reverse-transcription PCR analysis
Reverse-transcription PCR (RT-PCR) analysis was performed to detect gene expression. Total RNA was extracted from
three uterine tissues from each group using the TRIzol Reagent (Molecular
Research Center, Cincinnati, OH, USA) and then reverse-transcribed into cDNA
using Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).
cDNA was then subjected to RT-PCR to evaluate the relative gene expression
levels of the zona pellucida binding protein (ZPBP) and the
gene encoding peptidylprolyl isomerase A (PPIA) (internal
control), using appropriate primer pairs (Table 1). Amplification was
performed using a Perkin Elmer 9700 system (Applied Biosystems, Waltham, MA,
USA) under the following conditions: 95 ∘C for 5 min; 30 cycles of
95 ∘C for 30 s, 60 ∘C for 30 s, 72 ∘C for
30 s, and final elongation for 7 min at 72 ∘C. The amplification
products were separated on 2 % (w/v) agarose gel and quantified using a
Gel Logic model 200 imaging system (Kodak, Rochester, NY, USA).
Statistical analysis
Comparisons between groups were performed using t tests, with statistical
significance determined at p<0.05. The results are expressed as
means ± standard deviation (SD). Linear regression analyses were used
to test the relationships between ZPBP methylation status and sow litter size
traits (TNB and NBA). All statistical analyses were conducted using SPSS
software (version 20.0; SPSS Inc., Chicago, IL, USA).
Summary of sequencing results and reads alignment.
Group
SLG
LLG
Raw reads (no.)
1 248 683 696
1 217 238 456
(Read depth, X)
41.62 X
40.57 X
Analyzed reads (no.)
1 107 209 686
1 076 828 732
(%)
(88.67 %)
(88.46 %)
Mapped reads (no.)
662 804 470
614 402 588
(%)
(53.08 %)
(50.475 %)
Uniquely mapped reads (no.)
594 374 396
549 444 152
(%)
(47.60 %)
(45.14 %)
Results and discussion
Identification of the <italic>ZPBP</italic> gene as an epigenetic marker
GWBS was performed on gDNA from pooled uterus samples (n=3 for both SLG
and LLG). In total, 1249 and 1217 million raw reads were generated in SLG
and LLG, respectively. The mapped reads covered 53.08 % (SLG) and
50.48 % (LLG) of the pig genome (Table 2). A total of 3269 DMRs were
discovered; 1566 were hypermethylated and 1703 were hypomethylated in LLG
compared to SLG (Table 3). The DMRs were determined by considering the
p value
(<0.01) and false discovery rate (Q value <0.01). Among genes with
DMRs, ZPBP was found to be strongly related to fecundity by GO
enrichment analysis. This DMG was mainly observed at promoter regions (UP1kb;
1 kb region upstream of transcription start sites) and was hypomethylated in
LLG (Table 4).
Numbers and ratio of hyper-DMRs and
hypo-DMRs.
Sample
Hyper-DMRs
Hypo-DMRs
Total number
of DMRs
SLG vs. LLG
1566 (47.9 %)
1703 (52.1 %)
3269
DNA methylation plays an important role in regulating gene expression
(Wen et al., 2016). In particular, DNA methylation in
gene promoters is strongly associated with gene silencing (Bell et al.,
2011; Lande-Diner and Cedar, 2005; Weber et al., 2007). Recently, studies
have been conducted to identify the genome-wide methylation profiles of farm
animals (Hao et al., 2016; Hu et al., 2013; Xu et al., 2016; Zhang et
al., 2014). Some studies have described DNA methylation for the pig uterus
(Bartol et al., 2008; Franczak et al., 2017; Ko et al., 2008; Pistek et
al., 2013); however, few have reported uterine genome-wide methylation
patterns. GWBS, which allows unbiased genome-wide DNA methylation profiling,
has been used to investigate prolificacy-related DNA methylation in
unprecedented detail (Kurdyukov and Bullock, 2016).
In the current study, we used GWBS to investigate the DNA methylation
profiles of the genome in uterine tissues of high- and low-prolificacy pigs to explore the relationships between DNA methylation and litter size traits.
Information of DNA methylation of
ZPBP.
Gene
Chr
Start
End
DMR
Log
Difference
Pattern
p value
FDR
position
(L/S)
(S-L; cutoff 0.2)
(p<0.01)
(Q<0.01)
ZPBP
Chr 9
149 712 887
149 713 279
UP1kb
-101419348
0.22456
Hypo
1.32×10-14
1.89×10-11
FDR: false discovery rate; S: smaller litter size group;
L: larger litter size group.
Methylation analysis of the ZPBP gene in whole blood
samples of Berkshire sows by PMP assay. gDNAs were cut with the
methylation-sensitive restriction enzymes HpaII/MspI.
M: size marker; U: undigested DNA; SLG: smaller litter size group;
LLG: larger litter size group.
![]()
Confirmation of the methylation status of the <italic>ZPBP</italic> gene in whole blood by
PMP assay
To assess the prognostic capability of the ZPBP gene as a blood-based biomarker
for increased litter size, DNA methylation patterns of the ZPBP gene were
verified in whole blood samples collected from three sows, used to obtain
uterus tissues in each group by PMP assay. As shown in Fig. 2, we confirmed
that the ZPBP gene was hypomethylated in LLG. This result was consistent with
the results of GWBS analysis, and will allow early prediction of litter
sizes in prepubertal gilts from blood samples without slaughter.
Gene expression of hypomethylated <italic>ZPBP</italic> in the promoter
region
Next, to investigate the gene expression of ZPBP with hypomethylated promoter,
RT-PCR was performed on uterine tissues of three Berkshire sows from each
group. As shown in Fig. 4, ZPBP gene expression was significantly upregulated in
LLG, as expected. Promoter methylation generally impedes the binding of
transcription factors and in a second stage leads to chromatin
condensation, with long-term repression of gene expression
(Schubeler, 2015). Therefore, this result supports the hypothesis
that ZPBP overexpression in uterine tissue is due to promoter hypomethylation.
Correlation between methylation status of ZPBP gene and litter size
traits (TNB and NBA) in 172 Berkshire sows using logistic regression
analysis. The band intensities of PMP assay are shown on the x axis, and the
y axis shows TNB (a) and NBA (b). TNB: total number of piglets born;
NBA: number of piglets born alive: a.u: arbitrary unit.
![]()
As the DNA methylation status of promoter regions could affect gene
expression through changes in chromatin structure or transcription
efficiency (Klose and Bird, 2006; Lorincz et al., 2004), we compared the
genome-wide methylation patterns of high- and low-prolificacy pigs to
identify DMGs that might affect prolificacy traits such as litter size.
The effect on gene expression of promoter hypomethylated ZPBP in
uterine tissues by RT-PCR. The bars represent the mean ± SD; n=3.
∗ Significantly different between both groups at p<0.05. SLG: smaller litter size group; LLG: larger litter size group.
![]()
Verification of the relationship between methylation status of the
<italic>ZPBP</italic> gene and litter size traits
We verified the relationship between methylation status of the ZPBP
gene and litter size traits in Berkshire sows (n=172) using a PMP assay
(Fig. 4). The amplified products were normalized using undigested DNA
samples. To determine the relationship, linear regression analyses were
performed; the methylation status of the ZPBP gene exhibited
negative relationships with litter size traits. Logistic regression analyses
of the results of TNB (R2=0.1648) indicated the following: TNB
(y)=-6.0069×ZPBP(x)+10.879 (Fig. 3a). When NBA was included in the
model, the relationship was as follows: R2=0.1322; NBA (y)=-4.6643×ZPBP(x)+9.3843 (Fig. 3b). These results confirm that
ZPBP methylation status was significantly negatively associated with
litter size traits (TNB and NBA) and that sows with hypomethylated
ZPBP had high fecundity. Thus, the ZPBP gene can act as an
epigenetic marker for early prediction of litter size in Berkshire pigs.
Zona pellucida (ZP) is a filamentous matrix of well-structured and
glycosylated glycoproteins surrounding the oocyte that acts as a
morphological criterion for oocyte selection. This matrix is formed of three
proteins encoded by three different genes: ZP1, ZP2, and ZP3 (Pokkyla et
al., 2011; Wassarman, 2008). ZPBP, which localizes to the acrosomal membrane
and likely interacts with multiple acrosomal matrix proteins, was named for
its function, binding to the oocyte ZP protein following the acrosome
reaction (Yu et al., 2009). ZPBP mainly acts in acrosome
compaction and sperm morphogenesis during spermiogenesis. Most research on
ZPBP has focused on its location in the acrosome of the sperm and its
function in sperm–oocyte interactions during fertilization (Mori et al.,
1993, 1995; Yu et al., 2006). However, Campbell et al. (2006) reported
that murine ZPBP was a luminal epithelium-specific gene with
20-fold or higher expression in the uterine luminal epithelium than in the
stroma–glandular epithelium. Implantation is essential for the
establishment of normal pregnancy and is initiated by a physical interaction
between the trophoblast and the apical surface of the luminal epithelium,
followed rapidly by adhesion and then by penetration through the luminal
epithelium to the underlying stroma, which responds by decidualization
(Abrahamsohn and Zorn, 1993). In other words, the uterine
luminal epithelium plays a critical role in implantation. ZPBP is a serine
protease (serine protease 38) with ZP-binding properties that were initially
identified in porcine epididymal sperm (Mori et al., 1993). Serine
proteases are characterized by the presence of serine as a nucleophilic
amino acid at the active site of the enzyme (Hedstrom, 2002). Some
serine proteases are detectable in the uterus and are involved in female
reproduction, especially in oocyte development, ovulation, implantation, and
decidualization (Diao et al., 2013; Nie et al., 2005). Therefore, we
believe that ZPBP might play a role in female reproduction, including
implantation.