AABArchives Animal BreedingAABArch. Anim. Breed.2363-9822Copernicus PublicationsGöttingen, Germany10.5194/aab-60-27-2017SIRT1 gene polymorphisms associated with carcass traits in Luxi cattleLiuGuifenliuguifen126@126.comhttps://orcid.org/0000-0003-3300-8028ZhaoHongboTanXiuwenChengHaijianYouWeiWanFachunLiuYifanSongEnliangenliangs@126.comLiuXiaomuxmliu2002@163.comShandong Key Lab of Animal Disease Control and Breeding, Sangyuan Road 8 Number, Ji'nan City, Shandong Province, 250100, ChinaInstitute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road 8 Number, Ji'nan City, Shandong Province, 250100, ChinaThese authors contributed equally to this work.Guifen Liu (liuguifen126@126.com), Enliang Song (enliangs@126.com), and Xiaomu Liu (xmliu2002@163.com)13March2017601273211October201617February201728February2017This work is licensed under a Creative Commons Attribution 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by/3.0/This article is available from https://aab.copernicus.org/articles/60/27/2017/aab-60-27-2017.htmlThe full text article is available as a PDF file from https://aab.copernicus.org/articles/60/27/2017/aab-60-27-2017.pdf
SIRT1 is the gene that codes for Sirtuin 1, an NAD (nicotinamide adenine dinucleotide)-dependent class III
histone deacetylase. This gene plays a key role in adipose tissue and
muscle development in animals. Chinese Luxi cattle (n= 169) were selected
to identify SIRT1 SNPs (single nucleotide polymorphisms) and investigate the relationship of these
SNPs with carcass traits. Five SNPs (g.-382G > A,
g.-274C > G, g.17324T > C, g.17379A > G, and
g.17491G > A) were identified by direct sequencing. SNPs
g.-382G > A and g.-274C > G were located within the
promoter region of this gene. SNP g.-382G > A was significantly
associated with dressing percentage, meat percentage, and striploin and
ribeye weights, and the g.-274C > G polymorphism had a strong
effect on carcass, tenderloin, and high rib weights in Luxi cattle. These
findings will provide possible clues for the biological roles of
SIRT1 underlying beef cattle carcass traits.
Introduction
Sirtuin 1, also known as NAD (nicotinamide adenine dinucleotide)-dependent deacetylase Sirtuin 1, is an
NAD+-dependent protein deacetylase; it has many established protein
substrates and is thought to regulate an impressive list of biological
functions (McBurney et al., 2013). Sirtuin 1 has an important function in
endocrine signaling, specifically in glucose and fat metabolism in mammals
(Zillikens et al., 2009; Picard et al., 2004). Increased hepatic
SIRT1 activity enhances gluconeogenesis and inhibits glycolysis
(Rodgers et al., 2005; Zillikens et al., 2009). In the pancreatic β
cells, SIRT1 positively regulates insulin secretion in response to
glucose (Bordone et al., 2006). It is also involved in cellular
differentiation, apoptosis, metabolism, and aging (Shakibaei et al., 2012;
Sasaki et al., 2014; Luna et al., 2013; Gueguen et al., 2014).
Previous studies have suggested that SNPs (single nucleotide polymorphisms) within SIRT1 increase the
risk of obesity (De Oliveira et al., 2012), type 2 diabetes, and Parkinson's
disease (Schug and Li, 2011; Inamori et al., 2013; Shiota et al., 2012;
Civelek et al., 2013; Dong et al., 2011; Rai et al., 2012; Figarska et al.,
2013). In adipose tissue, Sirtuin 1 inhibits fat storage and
increases lipolysis via the repression of peroxisome proliferator-activated
receptor-γ (PPAR-γ). PPAR-γ is a key regulator in
adipogenesis and fat storage, controlling the expression of many
adipocyte-specific genes (Picard et al., 2004). These studies suggested that
Sirtuin 1 is a key regulator of whole-body energy balance and plays a role
in human health (Sasaki et al., 2014).
PCR primers and conditions for identification of SNPs in SIRT1 (NM_001192980).
SNPsPrimers (5′–3′)GenotypingTempRestrictionGenotypemethods(∘C)enzymepattern(bp)g.G-382AF: GTTTAGCCTTAACGCCGTTCAGGAAATT*ACRS56Vsp I166/136 + 30R: GTCTTTCAGAGTCTTCAAATCAGTGCCCg.C-274GF: GTATAGTCCACGGGGTTACAGPCR-RFLP59Sma I273/235 + 38R: CCAAACTTGTCTTTCAGAGTCg.T17324CF (inner): GTTAGTAAACTTCAGAATTGCTTTgCTT-ARMS-PCR58550 bp (outer)R (inner): TAATTTTTCCTACAAAACTAATATAAgGG270 bp (alleteT)F (outer): CTAGATGCTTTGAGATTGTCGTGTGTTG330 bp (alleteC)R (outer): ACTAAGCACACTATTTGAAACTTGAGTGg.A17379GF: TTCCAACCATCTCTTTGTCACACRS57EcoR I235/211 + 24R: AATAATAAGGCTTAATCTGAATT*g.G17491AF (inner): AAATACTGGCCTCAACTCTTAATTtTAT-ARMS-PCR58R (inner): AAATCCAAATTAACATCTGACATTTtAC477 bp (outer)F (outer): TACTTCGCAACTATACTCAGAACATAGA296 bp (alleteG)R (outer): GTTTGATCTCTAGGTTAGGAAGATCCT236 bp (alleteA)
Note: * purposeful mismatch was introduced in the sequence to
create a restriction site.
The bovine SIRT1 gene, which includes nine exons on chromosome 28,
is highly expressed in the liver and adipose tissue (Ghinis-Hozumi et al.,
2011). SIRT1 may play an important role in the development
of bovine adipose tissue in vivo. Although SIRT1, forkhead
box O1 (FOXO1), and PPAR-γ expression appear to be
nonlinear during the stages of preadipocyte differentiation, these genes
play an important role during bovine adipocyte development in Lilu cattle
(Liu et al., 2014). The study examined the variations of SIRT1 in
Luxi beef cattle by identified SNPs, and explored possible associations
between SIRT1 variants and carcass traits. These molecular markers
will provide some theoretical basis for improving cattle carcass characteristics.
Materials and methodsAnimals and genomic DNA isolation
In the Shandong
province, 169 Chinese Luxi cattle were reared in same conditions. The animals were slaughtered at the age of 24 months according
to Chinese national law (China Administration Rule of Laboratory Animal;
Operating Procedure of Cattle Slaughtering GB/T 19477-2004). Carcass traits
were recorded and blood samples were collected. Genomic DNA containing
nucleotides from leukocytes was isolated from blood samples and stored at
-20 ∘C following standard procedures (QIAamp DNA Blood Mini Kit, Qiagen, Germany).
SNP detection
We used the primer sequences from M. X. Li et al. (2013) (Table 1) to detect
SNPs. The 30 µL reaction volume included 15 µL Taq 2 × PCR
MasterMix (QUANSHIJIN, Beijing, China), 3 µL DNA template (20 ng µL-1),
9.6 µL ddH2O, and 1.2 µL of each primer (10 pmol µL-1).
The g.-382G > A and g.17379A > G polymorphisms were
genotyped using the amplification-created restriction site (ACRS) method
(Figarska et al., 2013). The tetra-primer amplification refractory mutation
system PCR (T-ARMS-PCR) was carried out to genotype SNPs
g.17324T > C and g.17491G > A (Haliassos et al., 1989).
The PCR reactions were performed in a total volume of 10 µL, containing
10 pmol of each of the inner primers, 1 pmol of each of the outer primers,
200 mM of each dNTP, 2 mM of MgCl2, 1 × PCR buffer, 50 ng of
DNA, and 0.2 U of Taq DNA polymerase (MBI, Fermentas, Waltham, MA, USA). To
increase the specificity of the reaction, a touchdown profile was followed.
Statistical analysis
DNA sequences were assembled and aligned for mutation analysis with DNASTAR
(DNAS Inc., Madison, WI, USA). Allele and genotype frequencies were directly
calculated. Heterozygosity,
effective number of alleles, and
polymorphic information content (PIC) were estimated based on Botstein et
al. (1980). A chi-square test assessed conformance with Hardy–Weinberg
equilibrium (HWE). Association of genotype with performance traits was
analyzed with the general linear model (GLM) procedure of SPSS 16.0.
Genotypic and allelic frequencies (%), value of χ2 test, and
diversity parameters of the bovine SIRT1 gene.
Schematic representation of the SIRT1 gene with the localization
of the five identified SNPs.
ResultsIdentification of SNPs
Five SNPs were detected in the exons, flanking introns, and promoter
sequences of SIRT1, including four transitions (G/A at
g.-382G > A, T/C at g.17324T > C, A/G at
g.17379A > G, and G/A at g.17491G > A) and one
transversion (g.-274C > G) (Fig. 1). The nomenclature adopted for
the SNPs was based on the convention described by the Human Genome Variation
Society (Den Dunnen et al., 2016). No SNPs were found in the coding sequence
from the set of animals used in this study. SNPs g.-382G > A and
g.-274C > G were located in the promoter region and could cause
disruption of several transcription factor binding sites, as predicted by
MatInspector release 8.0 (Cakir et al., 2009). The other three SNPs were
found in intron five. All five SNPs were successfully genotyped.
Genotypic and allelic frequencies, value of χ2 test, and PIC of
the bovine SIRT1 gene have been shown in Table 2. The g.-382G > A,
g.-274C > G, and g.17324T > C loci had moderate
polymorphism and thus genetic diversity, which implies that these SNPs have
a potential for selection. The g.17379A > G and
g.17491G > A loci had low genetic diversity and selection potential.
The relationship between SNPs and carcass traits
Significant differences between genotypes and carcass traits of beef cattle
are shown in Table 3. In g.-382G > A, AA genotypes have a more significant
difference (P< 0.05) in dressing percentage, meat percentage, and
striploin than the GG and GA genotypes; however, there is no difference in
ribeye. In g.-274C > G, AA genotypes have a more significant difference in
carcass, tenderloin and high rib weight than GG and GC genotypes. However,
no differences between SNPs and carcass traits were found when focusing on 17379A > G and g.17491G > A.
Significant SNP, genotype, and carcass trait associations.
Based on these results, we predicted potential differential transcription
factor (TF) binding sites according to the presence of different alleles
using MatInspector Release 8.0. At g.-382G > A, a myocyte-specific
enhancer factor 2 (MEF2) binding site was generated on substitution to the
A allele. At g.-274C > G, in the presence of the C allele, a binding
site for a CDE (cell-cycle-dependent element) was generated, whereas the same
binding site was abolished in the presence of the G allele.
Discussion
There are several variants associated with body mass index and risk of
obesity in human SIRT1 gene (Zillikens et al., 2009). Recent studies have
found possibly useful SNPs in the SIRT1 gene and explored the relationships
between these SNPs and ultrasound-measured carcass traits in Qinchuan
cattle (Gui et al., 2015). We identified five SNPs in bovine SIRT1
and estimated the extent of associations between these SNPs and carcass
traits in Chinese Luxi cattle.
Association analysis showed that SNP g.17379A > G was
significantly associated with tenderloin, striploin, and ribeye and that
polymorphisms with g.17324T > C had a strong effect on bone weight
(these effects became non-significant following the Bonferroni correction).
This SNP did not result in changes in amino acids. Such associations may be
a result of linkage disequilibrium between SIRT1 and other genes on
the same chromosome that have a significant effect on these carcass traits.
It is interesting to note that the SNP g.17379A > G was severely
out of HWE. Subsequent sequencing showed that this was not due to technical
error. We considered two possible explanations: (1) Luxi cattle have
experienced high selection pressure. Artificial selection led to the loss of
non-favored alleles. (2) The analyzed breed has an insufficiently large population size.
Five SNPs (g.-382G > A, g.-274C > G, g.17324T > C, g.17379A > G, and g.17491G > A)
were identified in the Luxi cattle and are similar to previous research results (Ye
et al., 2001; M. Li et al., 2013). The role of SIRT1 as an inhibitor
of adipogenesis and the recent demonstration of its involvement in white
adipose tissue “browning” (M. X. Li et al., 2013) as well as the roles played by SIRT1 in muscle metabolism (Qiang et al., 2012) have motivated us to further investigate the effects of the identified SNPs on beef cattle carcass traits. Our results showed that SNP
g.-382G > A was significantly associated with dressing percentage,
meat percentage, and striploin and ribeye weights, and g.-274C > G
polymorphism had a strong effect on carcass, tenderloin, and high rib
weights in Luxi cattle.
At g.-382G > A, a MEF2
binding site was generated on substitution to the A allele. At
g.-274C > G, in the presence of the C allele, a binding site for
a CDE was generated, whereas the same binding
site was abolished in the presence of the G allele. These indicated that
g.-382G > A and g.-274C > G polymorphisms might affect
the binding affinity of the surrounding sequences with TF and further
influence the activity of the SIRT1 promoter that was associated
with growth trait regulation.
Carcass traits are regulated by multiple genes and are influenced by
interactions among them; thus, the effects of these SNPs should be further
validated before they can be incorporated into beef cattle breeding practices.
The authors declare that they have no conflict of interest.
Acknowledgements
This study was supported by the Young Talents Training Program of Shandong
Academy of Agricultural Science, National Natural Science Foundation of
China (No. 31402098), the Sustentative Research Project of China Ministry of
Science and Technology (2015BAD03B04), Breeding New Varieties Projects of
Transgenic Organisms (2016ZX08007-002).
Edited by: S. Maak
Reviewed by: two anonymous referees
ReferencesBordone, L., Motta, M. C., Picard, F., Robinson, A., Jhala, U. S., Apfeld, J.,
McDonagh, T., Lemieux, M., McBurney, M., Szilvasi, A., Easlon, E. J., Lin, S.
J., and Guarente, L.: Sirt1 regulates insulin secretion by repressing UCP2 in
pancreatic beta cells, PLoS Biol., 4, e1002346, 10.1371/journal.pbio.1002346, 2006.
Botstein, D., White, R. L., Skolnick, M., and Davis, R. W.: Construction of a
genetic linkage map in man using restriction fragment length polymorphisms,
Am. J. Hum. Genet., 32, 314–331, 1980.Cakir, I., Perello, M., Lansari, O., Messier, N. J., Vaslet, C. A., and Nillni,
E. A.: Hypothalamic Sirt1 Regulates Food Intake in a Rodent Model System, PloS
One, 4, 8322, 10.1371/journal.pone.0008322, 2009.
Civelek, M., Hagopian, R., Pan, C., Che, N., Yang, W. P., Kayne, P. S., Saleem,
N. K., Cederberg, H., Kuusisto, J., Gargalovic, P. S., Kirchgessner, T. G.,
Laakso, M., and Lusis, A. J.: Genetic regulation of human adipose microRNA
expression and its consequences for metabolic traits, Hum. Molec. Gen., 22, 3023–3037, 2013.
Den Dunnen, J. T., Dalgleish, R., Maglott, D. R., Hart, R. K., Greenblatt, M. S.,
McGowan-Jordan, J., Roux, A. F., Smith, T., Antonarakis, S. E., and Taschner,
P. E.: HGVS recommendations for the description of sequence variants: 2016 update,
Hum. Mutat., 37, 564-569, 2016.De Oliveira, R. M., Sarkander, J., Kazantsev, A. G., and Outeiro, T. F.: SIRT2
as a Therapeutic Target for Age-Related Disorders, Front. Pharmacol., 3, 82,
10.3389/fphar.2012.00082, 2012.
Dong, Y., Guo, T., Traurig, M., Mason, C. C., Kobes, S., Perez, J., Knowler,
W. C., Bogardus, C., Hanson, R. L., and Baier, L. J.: SIRT1 is associated with
a decrease in acute insulin secretion and a sex specific increase in risk for
type 2 diabetes in Pima Indians, Molec. Gen. Metabol., 104, 661–665, 2011.Figarska, S. M., Vonk, J. M., and Boezen, H. M.: SIRT1 Polymorphism, Long-Term
Survival and Glucose Tolerance in the General Population, PloS One, 8, 58636,
10.1371/journal.pone.0058636, 2013.
Ghinis-Hozumi, Y., Gonzalez-Gallardo, A., Gonzalez-Davalos, L., Antaramian, A.,
Villarroya, F., Shimada, A., Varela-Echavarria, A., and Mora, O.: Bovine sirtuins:
initial characterization and expression of sirtuins 1 and 3 in liver, muscle,
and adipose tissue, J. Anim. Sci., 89, 2529–2536, 2011.Gueguen, C., Palmier, B., Plotkine, M., Marchand-Leroux, C., and Bessson, V.
C.: Neurological and histological consequences induced by in vivo cerebral
oxidative stress: evidence for beneficial effects of SRT1720, a sirtuin 1
activator, and sirtuin 1-mediated neuroprotective effects of poly(ADP-ribose)
polymerase inhibition, PloS One, 9, 87367, 10.1371/journal.pone.0087367, 2014.
Gui, L., Hao, R., Zhang, Y., Zhao, X., and Zan, L.: Haplotype distribution in
the class I sirtuin genes and their associations with ultrasound carcass traits
in Qinchuan cattle (Bos taurus), Molec. Cell. Probes, 29, 102–107, 2015.
Haliassos, A., Chomel, J. C., Tesson, L., Baudis, M., Kruh, J., Kaplan, J. C.,
and Kitzis, A.: Modification of enzymatically amplified DNA for the detection
of point mutations, Nucl. Acids Res., 17, 3606, 1989.
Inamori, T., Goda, T., Kasezawa, N., and Yamakawa-Kobayashi, K.: The combined
effects of genetic variation in the SIRT1 gene and dietary intake of n-3 and
n-6 polyunsaturated fatty acids on serum LDL-C and HDL-C levels: a population
based study, Lipids Health Dis., 12, 1–8, 2013.
Li, M., Sun, X., Hua, L., Lai, X., Lan, X., Lei, C., Zhang, C., Qi, X., and
Chen, H.: SIRT1 gene polymorphisms are associated with growth traits in Nanyang
cattle, Molec. Cell. Probes, 27, 215–220, 2013.Li, M. X., Sun, X. M., Zhang, L. Z., Wang, J., Huang, Y. Z., Sun, Y. J., Hu,
S. R., Lan, X. Y., Lei, C. Z., and Chen, H.: A novel c.-274C > G polymorphism
in bovine SIRT1 gene contributes to diminished promoter activity and is associated
with increased body size, Animal Gen., 44, 584–587, 2013.
Liu, X., Liu, G., Tan, X., Zhao, H., Cheng, H., Wan, F., Wu, N., and Song, E.:
Gene expression profiling of SIRT1, FoxO1, and PPARgamma in backfat tissues and
subcutaneous adipocytes of Lilu bulls, Meat Science, 96, 704–711, 2014.Luna, A., Aladjem, M. I., and Kohn, K. W.: SIRT1/PARP1 crosstalk: connecting DNA
damage and metabolism, Genome Integrity, 4, 6, 10.1186/2041-9414-4-6, 2013.
McBurney, M. W., Clark-Knowles, K. V., Caron, A. Z., and Gray, D. A.: SIRT1 is
a Highly Networked Protein That Mediates the Adaptation to Chronic Physiological
Stress, Genes Cancer, 4, 125–134, 2013.
Picard, F., Kurtev, M., Chung, N., Topark-Ngarm, A., Senawong, T., Machado de oliveira,
R., Leid, M., Mcburney, M. W., and Guarente, L.: Sirt1 promotes fat mobilization
in white adipocytes by repressing PPAR-gamma, Nature, 429, 771–776, 2004.
Picard, F., Kurtev, M., Chung, N., Topark-Ngarm, A., Senawong, T., Machado
De Oliveira, R., Leid, M., McBurney, M. W., and Guarente, L.: Sirt1 promotes
fat mobilization in white adipocytes by repressing PPAR-gamma, Nature, 429, 771–776, 2004.
Qiang, L., Wang, L., Kon, N., Zhao, W., Lee, S., Zhang, Y., Rosenbaum, M., Zhao,
Y., Gu, W., Farmer, S. R., and Accili, D.: Brown remodeling of white adipose
tissue by SirT1-dependent deacetylation of Ppargamma, Cell, 150, 620–632, 2012.Rai, E., Sharma, S., Kaul, S., Jain, K., Matharoo, K., Bhanwer, A. S., and
Bamezai, R. N.: The interactive effect of SIRT1 promoter region polymorphism
on type 2 diabetes susceptibility in the North Indian population, PloS One, 7,
e48621, 10.1371/journal.pone.0048621, 2012.
Rodgers, J. T., Lerin, C., Haas, W., Gygi, S. P., Spiegelman, B. M., and
Puigserver, P.: Nutrient control of glucose homeostasis through a complex of
PGC-1alpha and SIRT1, Nature 434, 113–118, 2005.
Sasaki, T., Kikuchi, O., Shimpuku, M., Susanti, V. Y., Yokota-Hashimoto, H.,
Taguchi, R., Shibusawa, N., Sato, T., Tang, L., Amano, K., Kitazumi, T., Kuroko,
M., Fujita, Y., Maruyama, J., Lee, Y. S., Kobayashi, M., Nakagawa, T., Minokoshi,
Y., Harada, A., Yamada, M., and Kitamura, T.: Hypothalamic SIRT1 prevents
age-associated weight gain by improving leptin sensitivity in mice,
Diabetologia, 57, 819–831, 2014.
Schug, T. T. and Li, X.: Sirtuin 1 in lipid metabolism and obesity, Ann. Med.,
43, 198–211, 2011.Shakibaei, M., Shayan, P., Busch, F., Aldinger, C., Buhrmann, C., Lueders, C.,
and Mobasheri, A.: Resveratrol Mediated Modulation of Sirt-1/Runx2 Promotes
Osteogenic Differentiation of Mesenchymal Stem Cells: Potential Role of Runx2
Deacetylation, PloS One, 7, 35712, 10.1371/journal.pone.0035712, 2012.
Shiota, A., Shimabukuro, M., Fukuda, D., Soeki, T., Sato, H., Uematsu, E.,
Hirata, Y., Rai, E., Sharma, S., Kaul, S., Jain, K., Matharoo, K., Bhanwer, A.
S., and Bamezai, R. N.: The interactive effect of SIRT1 promoter region polymorphism
on type 2 diabetes susceptibility in the North Indian population, PloS One, 7,
48621, 10.1371/journal.pone.0048621, 2012.
Ye, S., Dhillon, S., Ke, X., Collins, A. R., and Day, I. N.: An efficient
procedure for genotyping single nucleotide polymorphisms, Nucl. Acids Res., 29, 88–96, 2001.
Zillikens, M. C., van Meurs, J. B., Rivadeneira, F., Amin, N., Hofman, A.,
Oostra, B. A., Sijbrands, E. J., Witteman, J. C., Pols, H. A., van Duijn, C. M.,
and Uitterlinden, A. G.: SIRT1 genetic variation is related to BMI and risk of
obesity, Diabetes, 58, 2828–2834, 2009.