<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing with OASIS Tables v3.0 20080202//EN" "journalpub-oasis3.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:oasis="http://docs.oasis-open.org/ns/oasis-exchange/table" dtd-version="3.0">
  <front>
    <journal-meta>
<journal-id journal-id-type="publisher">AAB</journal-id>
<journal-title-group>
<journal-title>Archives Animal Breeding</journal-title>
<abbrev-journal-title abbrev-type="publisher">AAB</abbrev-journal-title>
<abbrev-journal-title abbrev-type="nlm-ta">Arch. Anim. Breed.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">2363-9822</issn>
<publisher><publisher-name>Copernicus Publications</publisher-name>
<publisher-loc>Göttingen, Germany</publisher-loc>
</publisher>
</journal-meta>

    <article-meta>
      <article-id pub-id-type="doi">10.5194/aab-60-199-2017</article-id><title-group><article-title>Identification and expression analysis of  <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> in dairy cattle</article-title>
      </title-group><?xmltex \runningtitle{Identification and expression analysis of  \textit{miR-144-5p} and \textit{miR-130b-5p} in dairy cattle}?><?xmltex \runningauthor{Z.~Li et al.}?>
      <contrib-group>
        <contrib contrib-type="author" corresp="no" rid="aff1 aff2">
          <name><surname>Li</surname><given-names>Zhixiong</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff3">
          <name><surname>Wang</surname><given-names>Hongliang</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Chen</surname><given-names>Ling</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Zhai</surname><given-names>Mengxing</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Chen</surname><given-names>Si</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Li</surname><given-names>Na</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="yes" rid="aff1">
          <name><surname>Liu</surname><given-names>Xiaolin</given-names></name>
          <email>liuxiaolin@nwsuaf.edu.cn</email>
        </contrib>
        <aff id="aff1"><label>1</label><institution>College of Animal Science and Technology, Northwest A&amp;F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling, Shaanxi 712100, P.R. China</institution>
        </aff>
        <aff id="aff2"><label>2</label><institution>College of Life Science and Technology, Southwest University for Nationalities, Chengdu 610041, P.R. China</institution>
        </aff>
        <aff id="aff3"><label>3</label><institution>State Key Laboratory for Molecular Biology of Special Economic Animals, Institute of Special Animal and Plant Sciences, Chinese Academy of Agricultural Sciences, Changchun 130112, P.R. China</institution>
        </aff>
      </contrib-group>
      <author-notes><corresp id="corr1">Xiaolin Liu (liuxiaolin@nwsuaf.edu.cn)</corresp></author-notes><pub-date><day>19</day><month>July</month><year>2017</year></pub-date>
      
      <volume>60</volume>
      <issue>3</issue>
      <fpage>199</fpage><lpage>204</lpage>
      <history>
        <date date-type="received"><day>9</day><month>October</month><year>2016</year></date>
           <date date-type="rev-recd"><day>10</day><month>May</month><year>2017</year></date>
           <date date-type="accepted"><day>13</day><month>June</month><year>2017</year></date>
      </history>
      <permissions>
<license license-type="open-access">
<license-p>This work is licensed under the Creative Commons Attribution 3.0 Unported License. To view a copy of this licence, visit <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/3.0/">https://creativecommons.org/licenses/by/3.0/</ext-link></license-p>
</license>
</permissions><self-uri xlink:href="https://aab.copernicus.org/articles/60/199/2017/aab-60-199-2017.html">This article is available from https://aab.copernicus.org/articles/60/199/2017/aab-60-199-2017.html</self-uri>
<self-uri xlink:href="https://aab.copernicus.org/articles/60/199/2017/aab-60-199-2017.pdf">The full text article is available as a PDF file from https://aab.copernicus.org/articles/60/199/2017/aab-60-199-2017.pdf</self-uri>


      <abstract>
    <p>MicroRNAs (miRNAs) can coordinate the main pathways involved in
innate and adaptive immune responses by regulating gene expression. To
explore the resistance to mastitis in cows, <italic>miR-144-5p</italic> and
<italic>miR-130b-5p</italic> were identified in bovine mammary gland tissue and
14 potential target genes belonging to the chemokine signaling pathway,
the arginine and proline metabolism pathway and the mRNA surveillance pathway were
predicted. Subsequently, we estimated the relative expression of
<italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> in cow mammary tissues by
using stem-loop quantitative real-time polymerase chain reaction. The results
showed that the relative expression of <italic>miR-144-5p</italic> and
<italic>miR-130b-5p</italic> in the mastitis-infected mammary tissues (<inline-formula><mml:math id="M1" display="inline"><mml:mrow><mml:mi>n</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">5</mml:mn></mml:mrow></mml:math></inline-formula>) was
significantly downregulated 0.14-fold (<inline-formula><mml:math id="M2" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>&lt;</mml:mo><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>) and upregulated 3.34-fold (<inline-formula><mml:math id="M3" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>&lt;</mml:mo><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), respectively, compared to healthy tissues (<inline-formula><mml:math id="M4" display="inline"><mml:mrow><mml:mi>n</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">5</mml:mn></mml:mrow></mml:math></inline-formula>). Our
findings reveal that <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> may have
important roles in resistance to mastitis in dairy cattle.</p>
  </abstract>
    </article-meta>
  </front>
<body>
      

<sec id="Ch1.S1" sec-type="intro">
  <title>Introduction</title>
      <p>Bovine mastitis, defined as  “an inflammation of the mammary gland”, is a prevalent and complex infectious disease affected by
genetics and pathogens that can result in significant dairy cattle losses (Nash et al., 2003).  Mastitis can be caused by many
bacteria, including <italic>Staphylococcus aureus</italic> and <italic>Escherichia coli</italic>. The primary defense against pathogens relies on
the appropriate expression of antigen-presenting molecules triggering the release of effector molecules in the innate immune
system. The immune system, as the central host determinant for dictating the outcome of intramammary infection, can defend against
in-breaking pathogens as the first line once the pathogens penetrate the physical barrier (Bannerman et al., 2009).</p>
      <p>Recent studies have shown that microRNAs (miRNAs) play important roles in
regulating and modulating innate and adaptive immune responses (Zhou et al.,
2012; Gu et al., 2012). Mature miRNAs are a class of small non-coding RNA molecules that are <inline-formula><mml:math id="M5" display="inline"><mml:mrow><mml:mo>∼</mml:mo><mml:mn mathvariant="normal">22</mml:mn></mml:mrow></mml:math></inline-formula> nucleotides
(nt) long processed from
<inline-formula><mml:math id="M6" display="inline"><mml:mo>∼</mml:mo></mml:math></inline-formula> 70 <inline-formula><mml:math id="M7" display="inline"><mml:mi mathvariant="normal">nt</mml:mi></mml:math></inline-formula> long precursor miRNAs (pre-miRNAs) that form hairpin
secondary structures and are evolutionarily conserved (Bartel et al., 2004;
Cullen et al., 2004; Kim et al., 2005). miRNAs are post-transcriptional
regulators that inhibit the translation or induce the degradation of protein-coding
protein mRNAs that contain complementary sequences to miRNAs (Berezikov,
2011; Bartel et al., 2009).</p>

<?xmltex \floatpos{t}?><table-wrap id="Ch1.T1" specific-use="star"><caption><p>The primer sequences of the stem-loop qPCR experiments.</p></caption><oasis:table frame="topbot"><oasis:tgroup cols="4">
     <oasis:colspec colnum="1" colname="col1" align="left"/>
     <oasis:colspec colnum="2" colname="col2" align="left"/>
     <oasis:colspec colnum="3" colname="col3" align="left"/>
     <oasis:colspec colnum="4" colname="col4" align="center"/>
     <oasis:thead>
       <oasis:row>  
         <oasis:entry colname="col1">miRNA name</oasis:entry>  
         <oasis:entry colname="col2">Primer</oasis:entry>  
         <oasis:entry colname="col3">Primer sequence</oasis:entry>  
         <oasis:entry colname="col4">Product</oasis:entry>
       </oasis:row>
       <oasis:row rowsep="1">  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2"/>  
         <oasis:entry colname="col3"/>  
         <oasis:entry colname="col4">size (bp)</oasis:entry>
       </oasis:row>
     </oasis:thead>
     <oasis:tbody>
       <oasis:row>  
         <oasis:entry colname="col1"><italic>miR-144-5p</italic></oasis:entry>  
         <oasis:entry colname="col2">Loop</oasis:entry>  
         <oasis:entry colname="col3">GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC<underline>CTTACAGT</underline></oasis:entry>  
         <oasis:entry colname="col4">59</oasis:entry>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">FW primer</oasis:entry>  
         <oasis:entry colname="col3">CCG<underline>GGATATCATCATATACTGTAAG</underline></oasis:entry>  
         <oasis:entry colname="col4"/>
       </oasis:row>
       <oasis:row rowsep="1">  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">RW primer</oasis:entry>  
         <oasis:entry colname="col3">GTGCAGGGTCCGAGGT</oasis:entry>  
         <oasis:entry colname="col4"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"><italic>miR-130b-5p</italic></oasis:entry>  
         <oasis:entry colname="col2">Loop</oasis:entry>  
         <oasis:entry colname="col3">GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC<underline>AGTAGTGC</underline></oasis:entry>  
         <oasis:entry colname="col4">59</oasis:entry>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">FW primer</oasis:entry>  
         <oasis:entry colname="col3">CGG<underline>ACTCTTTCCCTGTTGCACTACT</underline></oasis:entry>  
         <oasis:entry colname="col4"/>
       </oasis:row>
       <oasis:row rowsep="1">  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">RW primer</oasis:entry>  
         <oasis:entry colname="col3">GTGCAGGGTCCGAGGT</oasis:entry>  
         <oasis:entry colname="col4"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1">18S-snRNA</oasis:entry>  
         <oasis:entry colname="col2">FW primer</oasis:entry>  
         <oasis:entry colname="col3">GTGGTGTTGAGGAAAGCAGACA</oasis:entry>  
         <oasis:entry colname="col4">79</oasis:entry>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">RW primer</oasis:entry>  
         <oasis:entry colname="col3">TGATCACACGTTCCACCTCATC</oasis:entry>  
         <oasis:entry colname="col4"/>
       </oasis:row>
     </oasis:tbody>
   </oasis:tgroup></oasis:table><table-wrap-foot><p>Note: the underlined letters are the sequences from <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic>.</p></table-wrap-foot></table-wrap>

      <p><italic>miR-144</italic> plays a crucial role in hemoglobin synthesis during primitive erythropoiesis and is associated with anemia
severity in sickle-cell diseases (Fu et al., 2009; Sangokoya et al., 2010). <italic>miR-130b</italic> inhibits cell proliferation and
invasion in pancreatic cancer through targeting <italic>STAT3</italic> and targets <italic>DICER1</italic> for aggression in endometrial cancer
(Zhao et al., 2013; Li et al., 2013). <italic>miR-130b</italic> is associated with poor prognosis in colorectal cancer and is a prognostic
marker (Colangelo et al., 2013). Our previous research showed two differentially expressed miRNAs matched to bta-mir-144 and
bta-mir-130b that were detected in the peripheral blood of healthy and mastitis-infected dairy cattle (Li et al., 2014a). However, our
knowledge of the differential expression of the two miRNAs in cattle mastitis resistance remains largely limited. The two
miRNAs may have important roles in the development of the immune system against pathological changes in mammary tissue in dairy
cattle.</p>
      <p>The aims of this study were (1) to investigate whether <italic>miR-144-5p</italic>
and <italic>miR-130b-5p</italic> are present in bovine tissues, (2) to predict the
target genes <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> and (3) to analyze
whether <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> are differentially
expressed in healthy and mastitis-infected mammary tissues.</p>
</sec>
<sec id="Ch1.S2">
  <title>Materials and methods</title>
<sec id="Ch1.S2.SS1">
  <title>Animal samples</title>
      <p>Samples were collected from five healthy and five mastitis-infected Chinese Holstein cows of first lactation from a commercial
bovine slaughter farm.  The selection of mastitis-infected cows was carried out as previously described (Li et al., 2014b). A part of
the 10 mammary tissue samples was collected and stored in liquid nitrogen for RNA isolation; others were used for the
identification of the pathogen. All 10 mammary tissue samples were used for analysis of the expression profile of
<italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic>. The liver, heart, lung, kidney and spleen from five healthy samples were used to analyze
the expression pattern. This study was approved by the Northwest A&amp;F University Animal Care and Use Committee.</p>
</sec>
<sec id="Ch1.S2.SS2">
  <title>RNA extraction and cDNA synthesis</title>
      <p>Total RNA was extracted using Trizol Reagent (Invitrogen, USA) following the manufacturer protocol. RNA purity was verified by
measuring the absorbance at 260 and 280 <inline-formula><mml:math id="M8" display="inline"><mml:mi mathvariant="normal">nm</mml:mi></mml:math></inline-formula> with an ND-1000 spectrophotometer (NanoDrop Technologies, USA).  First-strand cDNA
synthesis was performed in a 20 <inline-formula><mml:math id="M9" display="inline"><mml:mrow><mml:mi mathvariant="normal">µ</mml:mi><mml:mi mathvariant="normal">L</mml:mi></mml:mrow></mml:math></inline-formula> volume using a PrimeScript RT reagent kit (Takara, Japan) following the
manufacturer protocol with a specific stem-loop primer. The primers for the reverse transcription polymerase chain reaction
(RT-PCR) are shown in Table 1.</p>
      <p>To identify <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> expressed in the mammary tissue of dairy cattle, primers were designed
according to the sequences previously detected (Li et al., 2014).  PCR was performed in a total volume of 25 <inline-formula><mml:math id="M10" display="inline"><mml:mrow><mml:mi mathvariant="normal">µ</mml:mi><mml:mi mathvariant="normal">L</mml:mi></mml:mrow></mml:math></inline-formula>
containing 50 <inline-formula><mml:math id="M11" display="inline"><mml:mi mathvariant="normal">ng</mml:mi></mml:math></inline-formula> of cDNA, 2.5 <inline-formula><mml:math id="M12" display="inline"><mml:mrow><mml:mi mathvariant="normal">µ</mml:mi><mml:mi mathvariant="normal">L</mml:mi></mml:mrow></mml:math></inline-formula> 10 <inline-formula><mml:math id="M13" display="inline"><mml:mo>×</mml:mo></mml:math></inline-formula> PCR buffer, 2.1 <inline-formula><mml:math id="M14" display="inline"><mml:mi mathvariant="normal">mM</mml:mi></mml:math></inline-formula> <inline-formula><mml:math id="M15" display="inline"><mml:mrow class="chem"><mml:msub><mml:mi mathvariant="normal">MgCl</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msub></mml:mrow></mml:math></inline-formula>, 0.1 <inline-formula><mml:math id="M16" display="inline"><mml:mi mathvariant="normal">mM</mml:mi></mml:math></inline-formula> dNTPs,
0.25 <inline-formula><mml:math id="M17" display="inline"><mml:mi mathvariant="normal">mM</mml:mi></mml:math></inline-formula> of each primer, 0.2 <inline-formula><mml:math id="M18" display="inline"><mml:mrow><mml:mi mathvariant="normal">µ</mml:mi><mml:mi mathvariant="normal">L</mml:mi></mml:mrow></mml:math></inline-formula> Easy Taq DNA polymerase and dd<inline-formula><mml:math id="M19" display="inline"><mml:mrow class="chem"><mml:msub><mml:mi mathvariant="normal">H</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msub><mml:mi mathvariant="normal">O</mml:mi></mml:mrow></mml:math></inline-formula> run for 32 cycles at 95<inline-formula><mml:math id="M20" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>
for 40 <inline-formula><mml:math id="M21" display="inline"><mml:mi mathvariant="normal">s</mml:mi></mml:math></inline-formula>, 60<inline-formula><mml:math id="M22" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula> for 30 <inline-formula><mml:math id="M23" display="inline"><mml:mi mathvariant="normal">s</mml:mi></mml:math></inline-formula> and 72<inline-formula><mml:math id="M24" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula> for 30 <inline-formula><mml:math id="M25" display="inline"><mml:mi mathvariant="normal">s</mml:mi></mml:math></inline-formula>, followed by incubation at 72<inline-formula><mml:math id="M26" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula> for
10 <inline-formula><mml:math id="M27" display="inline"><mml:mi mathvariant="normal">min</mml:mi></mml:math></inline-formula>. PCR products were ligated into the T-Vector pMD19 (Takara, Japan) after gel extraction and then transformed into
competent <italic>E. coli</italic> DH5<inline-formula><mml:math id="M28" display="inline"><mml:mi mathvariant="italic">α</mml:mi></mml:math></inline-formula>. Finally, 10 randomly selected positive clones were sequenced. The experiment was repeated
twice to confirm the result.</p>
</sec>
<sec id="Ch1.S2.SS3">
  <title>Sequence analysis</title>
      <p>Sequence alignment was performed to verify <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> using DNAman (version 6.0) software. To
obtain the potential target genes of <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic>, the prediction of the target gene was performed
with
MIREAP software. The predicted target genes were classified by KEGG functional annotations; the identified pathways were actively
regulated by <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> in healthy and mastitis-infected dairy cattle.</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F1" specific-use="star"><caption><p><bold>(a)</bold> Sequencing chromatograms for <italic>miR-144-5p</italic>.
<bold>(b)</bold> Sequencing chromatograms for <italic>miR-130b-5p</italic>.
<bold>(c)</bold> The bta-mir-144 sequence comparison with <italic>bta-miR-144</italic> and
<italic>miR-144-5p</italic>. <bold>(d)</bold> The bta-mir-130b sequence comparison with
<italic>bta-miR-130b</italic> and <italic>miR-130b-5p</italic>.</p></caption>
          <?xmltex \igopts{width=406.874409pt}?><graphic xlink:href="https://aab.copernicus.org/articles/60/199/2017/aab-60-199-2017-f01.png"/>

        </fig>

</sec>
<sec id="Ch1.S2.SS4">
  <title>Quantitative analysis of miRNAs</title>
      <p>Stem-loop quantitative real-time polymerase chain reaction (stem-loop qPCR)
was used to analyze miRNAs according to Chen et al. (2005). The stem-loop
qPCR was performed in the Bio-Rad CFX96 Real-Time PCR Detection System using
the SYBR Green PCR kit (Takara, Japan) according to the manufacturer
instructions. 18S rRNA was used as the reference gene in the stem-loop qPCR
detection of bovine miRNAs, and all reactions were run in triplicate. The
relative expression level of <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> was
calculated according to the method of Livak and Schmittgen (2001). The
primers for the qPCR are shown in Table 1.</p>
</sec>
<sec id="Ch1.S2.SS5">
  <title>Statistical analysis</title>
      <p>The value of the relative quantity was presented as fold change. The means of
two groups were compared by a Student's paired-samples <inline-formula><mml:math id="M29" display="inline"><mml:mi>t</mml:mi></mml:math></inline-formula> test. The analysis
was performed with SPSS software (version 20.0); <inline-formula><mml:math id="M30" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>&lt;</mml:mo><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula> was regarded as
significant.</p>
</sec>
</sec>
<sec id="Ch1.S3">
  <title>Results</title>
<sec id="Ch1.S3.SS1">
  <?xmltex \opttitle{Identification of \textit{miR-144-5p} and \textit{miR-130b-5p}}?><title>Identification of <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic></title>
      <p>RT-PCR and sequencing were used to identify <italic>miR-144-5p</italic> and
<italic>miR-130b-5p</italic> with specific primers (Fig. 1a and b). The miRNAs of
<italic>bta-miR-144</italic> and <italic>bta-miR-130b</italic> from miRBase
(<uri>http://www.mirbase.org/</uri>) are matched to the <inline-formula><mml:math id="M31" display="inline"><mml:mrow><mml:msup><mml:mn mathvariant="normal">3</mml:mn><mml:mo>′</mml:mo></mml:msup></mml:mrow></mml:math></inline-formula> of
bta-mir-144 and bta-mir-130b. The cloned miRNAs are totally
matched to the <inline-formula><mml:math id="M32" display="inline"><mml:mrow><mml:msup><mml:mn mathvariant="normal">5</mml:mn><mml:mo>′</mml:mo></mml:msup></mml:mrow></mml:math></inline-formula> of bta-mir-144 and bta-mir-130b (Fig. 1c and d),
so we called them <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic>.</p>

<?xmltex \floatpos{t}?><table-wrap id="Ch1.T2"><caption><p>Target genes of <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic>.</p></caption><oasis:table frame="topbot"><oasis:tgroup cols="3">
     <oasis:colspec colnum="1" colname="col1" align="left"/>
     <oasis:colspec colnum="2" colname="col2" align="left"/>
     <oasis:colspec colnum="3" colname="col3" align="left"/>
     <oasis:thead>
       <oasis:row rowsep="1">  
         <oasis:entry colname="col1">miRNA name</oasis:entry>  
         <oasis:entry colname="col2">Gene name</oasis:entry>  
         <oasis:entry colname="col3">KEGG pathway name</oasis:entry>
       </oasis:row>
     </oasis:thead>
     <oasis:tbody>
       <oasis:row>  
         <oasis:entry colname="col1"><italic>miR-144-5p</italic></oasis:entry>  
         <oasis:entry colname="col2">CXCL2</oasis:entry>  
         <oasis:entry colname="col3">Chemokine signaling pathway</oasis:entry>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">CRK</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry rowsep="1" colname="col2">GNB5</oasis:entry>  
         <oasis:entry rowsep="1" colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">NOS2</oasis:entry>  
         <oasis:entry colname="col3">Arginine and proline metabolism</oasis:entry>
       </oasis:row>
       <oasis:row rowsep="1">  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">ARG1</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"><italic>miR-130b-5p</italic></oasis:entry>  
         <oasis:entry colname="col2">AMD1</oasis:entry>  
         <oasis:entry colname="col3">Arginine and proline metabolism</oasis:entry>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">SAT2</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">ARG1</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry rowsep="1" colname="col2">GLS2</oasis:entry>  
         <oasis:entry rowsep="1" colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">PPP2R2B</oasis:entry>  
         <oasis:entry colname="col3">mRNA surveillance pathway</oasis:entry>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">PPP2CB</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">SMG1</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry rowsep="1" colname="col2">SAP18</oasis:entry>  
         <oasis:entry rowsep="1" colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">CHUK</oasis:entry>  
         <oasis:entry colname="col3">Chemokine signaling pathway</oasis:entry>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">CXCL2</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">CXCL6</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">GNAT2</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">CCL11</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">NRAS</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
       <oasis:row>  
         <oasis:entry colname="col1"/>  
         <oasis:entry colname="col2">BRAF</oasis:entry>  
         <oasis:entry colname="col3"/>
       </oasis:row>
     </oasis:tbody>
   </oasis:tgroup></oasis:table></table-wrap>

</sec>
<sec id="Ch1.S3.SS2">
  <?xmltex \opttitle{Target gene prediction of \textit{miR-144-5p} and \textit{miR-130b-5p}}?><title>Target gene prediction of <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic></title>
      <p>Twenty potential target genes of <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic>
were predicted using MIREAP software (Table 2). Ten target genes of
<italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> belong to the chemokine signaling
pathway, which plays an important role in inflammatory responses and cancer
(Coussens and Werb, 2002; Charo and Ransohoff, 2006; Baggiolini and
Loetscher, 2000). Six target genes of <italic>miR-144-5p</italic> and
<italic>miR-130b-5p</italic> belong to the arginine and proline metabolism pathway, which
is closely involved in conceptus metabolism, growth and development. Four
target genes of <italic>miR-130b-5p</italic> belong to the mRNA surveillance pathway,
which ensures the viability and quality of mRNA.</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F2" specific-use="star"><caption><p>Relative expression of <italic>miR-144-5p</italic>. <bold>(a)</bold> Relative
expression of <italic>miR-144-5p</italic> in healthy and mastitis-infected mammary
gland tissues using qPCR. H-MG denotes healthy mammary gland and M-MG denotes
mastitis-infected mammary gland. <bold>(b)</bold> Relative expression of
<italic>miR-144-5p</italic> in a variety of healthy tissues using qPCR. H denotes
the healthy cow group. The vertical bar represents the standard error.</p></caption>
          <?xmltex \igopts{width=341.433071pt}?><graphic xlink:href="https://aab.copernicus.org/articles/60/199/2017/aab-60-199-2017-f02.png"/>

        </fig>

      <?xmltex \floatpos{t}?><fig id="Ch1.F3" specific-use="star"><caption><p>Relative expression of <italic>miR-130b-5p</italic>. <bold>(a)</bold> Relative
expression of <italic>miR-130b-5p</italic> in healthy and mastitis-infected mammary
gland tissues using qPCR. H-MG denotes healthy mammary gland and M-MG denotes
mastitis-infected mammary gland. <bold>(b)</bold> Relative expression of
<italic>miR-130b-5p</italic> in a variety of healthy tissues using qPCR. H denotes
the healthy cow group. The vertical bar represents the standard error.</p></caption>
          <?xmltex \igopts{width=341.433071pt}?><graphic xlink:href="https://aab.copernicus.org/articles/60/199/2017/aab-60-199-2017-f03.png"/>

        </fig>

<?xmltex \hack{\newpage}?>
</sec>
<sec id="Ch1.S3.SS3">
  <?xmltex \opttitle{Expression of \textit{miR-144-5p} and \textit{miR-130b-5p} in healthy and mastitic cow tissues}?><title>Expression of <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> in healthy and mastitic cow tissues</title>
      <p>The expression of <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> in healthy and
mastitis-infected mammary tissues was investigated using stem-loop qPCR.
A lower expression of <italic>miR-144-5p</italic> was observed in the
mastitis-infected mammary tissues compared to that in the healthy samples
(Fig. 2a; <inline-formula><mml:math id="M33" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>&lt;</mml:mo><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>). The expression of <italic>miR-144-5p</italic> in mammary
glands was higher than that in other tissues, including the heart, liver, spleen,
lung and kidney in the healthy cows (Fig. 2b). The expression of the
<italic>miR-130b-5p</italic> was much higher in the mastitis-infected mammary gland
tissues compared to that in the healthy samples (Fig. 3a; <inline-formula><mml:math id="M34" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>&lt;</mml:mo><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>). The
expression of <italic>miR-130b-5p</italic> in mammary glands was higher than that
in other tissues, including the liver, heart, lung, kidney and spleen in the
healthy cows (Fig. 3b). The findings suggest that <italic>miR-144-5p</italic> and
<italic>miR-130b-5p</italic> are highly correlated with mastitis.</p>
</sec>
</sec>
<sec id="Ch1.S4">
  <title>Discussion</title>
      <p>Through sequencing alignment, <italic>bta-miR-144</italic> and <italic>bta-miR-130b</italic> from
miRBase are actually <italic>miR-144-3p</italic> and <italic>miR-130b-5p</italic>; the cloned
miRNAs in our study are <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic>. In the
present study, <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> were identified
in mammary, heart, liver, spleen, lung and kidney tissues at different
expression levels, which may indicate functional differences.</p>
      <p>Twenty potential target genes of <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic>
were predicted, and 10 of them belonged to the chemokine signaling pathway, which
plays an important role in orchestrating leukocyte migration under normal
conditions and during inflammatory responses (Mellado et al., 2001), such as
<italic>CXCR4</italic> (Lapteva et al., 2005; Balkwill, 2004) and <italic>CXCR2</italic>
(Acosta et al., 2008). Another important pathway including six target genes
is arginine and proline metabolism, which is known to be closely involved in
conceptus metabolism (Wu et al., 2008), growth and development. It is also a potential treatment for intrauterine growth restriction (Wu et al.,
2009), which is a significant problem in both human medicine and animal
agriculture. Four of them belonged to the mRNA surveillance pathway, which
assesses the quality of mRNAs to ensure that they are suitable for
translation (Vasudevan et al., 2002). mRNA surveillance facilitates the
detection and destruction of mRNAs that contain premature termination codons
(Wagner and Lykke-Andersen, 2002). Whether these genes are regulated directly
by <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> needs to be confirmed in a further
study.</p>
</sec>
<sec id="Ch1.S5" sec-type="conclusions">
  <title>Conclusions</title>
      <p>In summary, the differential expression of <italic>miR-144-5p</italic> and
<italic>miR-130b-5p</italic> in healthy and mastitis-infected mammary glands
indicates that <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> may play
important roles in inflammation response. There could be
a relationship between <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> and
mastitis in Chinese Holstein cattle. Our findings suggest that the
differential expression of the post-transcriptional regulators
<italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> may bind to complementary
sequences of target mRNAs, resulting in different translational
bovine repression. <italic>miR-144-5p</italic> and <italic>miR-130b-5p</italic> likely
play critical roles in mastitis resistance in dairy cattle.</p>
</sec>

      
      </body>
    <back><notes notes-type="dataavailability">

      <p>The original data for the paper are available upon request from the corresponding author.</p>
  </notes><notes notes-type="competinginterests">

      <p>The authors declare that they have no conflict of interest.</p>
  </notes><ack><title>Acknowledgements</title><p>This study was supported by the National 863 Program of China (2008AAl02144), the“13115” Sci-Tech Innovation Program of Shaanxi Province
(2008ZDKG-11)
and the Xi'an city science and technology project (NC09049-2). Comments from
anonymous reviewers have greatly improved the paper.<?xmltex \hack{\newline}?><?xmltex \hack{\newline}?> Edited by: Steffen Maak<?xmltex \hack{\newline}?> Reviewed by: three
anonymous referees</p></ack><ref-list>
    <title>References</title>

      <ref id="bib1.bib1"><label>1</label><mixed-citation>
Acosta, J. C., O'Loghlen, A., Banito, A., Guijarro, M. V., Augert, A., Raguz, S., Fumagalli, M.,
Da Costa, M., Brown, C., Popov, N., Takatsu, Y., Melamed, J., d'Adda di Fagagna, F., Bernard, D., Hernando, E., and Gil, J.: Chemokine signaling via
the CXCR2 receptor reinforces senescence, Cell, 133, 1006–1018, 2008.</mixed-citation></ref>
      <ref id="bib1.bib2"><label>2</label><mixed-citation>
Baggiolini, M. and Loetscher, P.: Chemokines in inflammation and
immunity, Immunol. Today, 21, 418–420,
2000.</mixed-citation></ref>
      <ref id="bib1.bib3"><label>3</label><mixed-citation>
Balkwill, F.: The significance of cancer cell expression of the chemokine receptor CXCR4, Semin. Cancer Biol., 14,
171–179, 2004.</mixed-citation></ref>
      <ref id="bib1.bib4"><label>4</label><mixed-citation> Bannerman, D. D.: Pathogen-dependent induction of cytokines and other soluble inflammatory mediators during
intramammary infection of dairy cows, J. Anim. Sci., 87, 10–25, 2005.</mixed-citation></ref>
      <ref id="bib1.bib5"><label>5</label><mixed-citation> Bartel, D. P.: MicroRNAs, genomics, biogenesis, mechanism, and function, Cell, 116, 281–297, 2004.</mixed-citation></ref>
      <ref id="bib1.bib6"><label>6</label><mixed-citation> Bartel, D. P.: MicroRNAs, target recognition and regulatory functions, Cell, 136, 215–233, 2009.</mixed-citation></ref>
      <ref id="bib1.bib7"><label>7</label><mixed-citation> Berezikov, E.: Evolution of microRNA diversity and regulation in animals, Nature Rev. Genet., 12, 846–860, 2011.</mixed-citation></ref>
      <ref id="bib1.bib8"><label>8</label><mixed-citation> Charo, I. F. and Ransohoff, R. M.: The many roles of chemokines and chemokine receptors in inflammation, New
Engl. J. Med., 354, 610–621, 2006.</mixed-citation></ref>
      <ref id="bib1.bib9"><label>9</label><mixed-citation>Chen, C., Ridzon, D. A., Broomer, A. J., Zhou, Z., Lee, D. H., Nguyen, J. T., Barbisin, M., Xu, N. L., Mahuvakar, V. R., Andersen, M. R., Lao, K. Q., Livak, K. J., and Guegler, K. J.: Real-time quantification of
microRNAs by stem–loop RT–PC R, Nucleic Acids Res., 33, e179, <ext-link xlink:href="https://doi.org/10.1093/nar/gni178" ext-link-type="DOI">10.1093/nar/gni178</ext-link>, 2005.</mixed-citation></ref>
      <ref id="bib1.bib10"><label>10</label><mixed-citation>
Colangelo, T., Fucci, A., Votino, C., Sabatino, L., Pancione, M., Laudanna, C.,
Binaschi, M., Bigioni, M., Maggi, C. A., Parente, D., Forte, N., and Colantuoni, V.: MicroRNA-130b promotes tumor
development and is associated with poor prognosis in colorectal cancer, Neoplasia, 15, 1218–1231, 2013.</mixed-citation></ref>
      <ref id="bib1.bib11"><label>11</label><mixed-citation> Coussens, L. M. and Werb, Z.: Inflammation and cancer, Nature, 420, 860–867, 2002.</mixed-citation></ref>
      <ref id="bib1.bib12"><label>12</label><mixed-citation> Cullen, B. R.: Transcription and processing of human microRNA precursors, Mol. Cell, 16, 861–865, 2004.</mixed-citation></ref>
      <ref id="bib1.bib13"><label>13</label><mixed-citation>
Fu, Y. F., Du, T. T., Dong, M., Zhu, K. Y., Jing, C. B., Zhang, Y., Wang, L., Fan, H. B., Chen, Y., Jin, Y., Yue, G. P., Chen, S. J., Chen, Z., Huang, Q. H., Jing, Q., Deng, M., and Liu, T. X.: Mir-144 selectively regulates
embryonic a-hemoglobin synthesis during primitive erythropoiesis, Blood, 113, 1340–1349, 2009.</mixed-citation></ref>
      <ref id="bib1.bib14"><label>14</label><mixed-citation>Gu, Y., Li, M., Wang, T., Liang, Y., Zhong, Z., Wang, X., Zhou, Q., Chen, L., Lang, Q., He, Z., Chen, X., Gong, J., Gao, X., Li, X., and Lv, X.: Lactation-related MicroRNA
expression profiles of porcine breast milk exosomes, PLoS One, 7, e43691, <ext-link xlink:href="https://doi.org/10.1371/journal.pone.0043691" ext-link-type="DOI">10.1371/journal.pone.0043691</ext-link>, 2012.</mixed-citation></ref>
      <ref id="bib1.bib15"><label>15</label><mixed-citation> Kim, V. N.: MicroRNA biogenesis, coordinated cropping and dicing, Nat. Rev. Mol. Cell Bio., 6, 376–385, 2005.</mixed-citation></ref>
      <ref id="bib1.bib16"><label>16</label><mixed-citation> Lapteva, N., Yang, A. G., Sanders, D. E., Strube, R. W., and Chen, S. Y.: CXCR4 knockdown by small interfering RNA
abrogates breast tumor growth in vivo, Cancer Gene Ther., 12, 84–89, 2005.</mixed-citation></ref>
      <ref id="bib1.bib17"><label>17</label><mixed-citation> Li, B. L., Lu, C., Lu, W., Yang, T. T., Qu, J., Hong, X., and Wan, X. P.: miR-130b is an EMT-related microRNA that
targets DICER1 for aggression in endometrial cancer, Med. Oncol., 30, 484–484, 2013.</mixed-citation></ref>
      <ref id="bib1.bib18"><label>18</label><mixed-citation> Li, Z. X., Wang, H. L., Chen, L., Wang, L. J., Liu, X. L., Ru, C. X., and Song, A. L.: Identification and
characterization of novel and differentially expressed microRNAs in peripheral blood from healthy and mastitis Holstein cattle
by deep sequencing, Anim. Genet., 45, 20–27, 2014a.</mixed-citation></ref>
      <ref id="bib1.bib19"><label>19</label><mixed-citation> Li, Z. X., Zhang, H. L., Song, N., Wang, H. L., Chen, L., Zhai, M. X., and Liu, X. L.: Molecular cloning,
characterization and expression of miR-15a-3p and miR-15b-3p in dairy cattle, Mol. Cell. Probe., 28, 255–258, 2014b.</mixed-citation></ref>
      <ref id="bib1.bib20"><label>20</label><mixed-citation> Livak, K. J. and Schmittgen, T. D.: Analysis of relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) method, Methods, 25, 402–408, 2001.</mixed-citation></ref>
      <ref id="bib1.bib21"><label>21</label><mixed-citation> Mellado, M., Rodríguez-Frade, J. M., Mañes, S., Martínez-A, C.: Chemokine signaling and functional
responses: The role of receptor dimerization and TK pathway activation, Annu. Rev. Immunol., 19, 397–421, 2001.</mixed-citation></ref>
      <ref id="bib1.bib22"><label>22</label><mixed-citation> Nash, D. L., Rogers, G. W., Cooper, J. B., Hargrove, G. L., and Keown, J. F.: Heritability of intramammary infections
at first parturition and relationships with sire transmitting abilities for somatic cell score, udder type traits, productive
life, and protein yield, J. Dairy Sci., 86, 2684–2695, 2003.</mixed-citation></ref>
      <ref id="bib1.bib23"><label>23</label><mixed-citation> Sangokoya, C., Telen, M. J., and Chi, J. T.: microRNA miR-144 modulates oxidative stress tolerance and associates
with anemia severity in sickle cell disease, Blood, 116, 4338–4348, 2010.</mixed-citation></ref>
      <ref id="bib1.bib24"><label>24</label><mixed-citation> Vasudevan, S., Peltz, S. W., and Wilusz, C. J.: Non-stop decay – a new mRNA surveillance pathway, Bioessays, 24,
785–788, 2002.</mixed-citation></ref>
      <ref id="bib1.bib25"><label>25</label><mixed-citation> Wagner, E. and Lykke-Andersen, J.: mRNA surveillance: the perfect persist, J. Cell Sci., 115, 3033–3038, 2002.</mixed-citation></ref>
      <ref id="bib1.bib26"><label>26</label><mixed-citation> Wu, G., Bazer, F. W., Datta, S., Johnson, G. A., Li, P., Satterfield, M. C., and Spencer, T. E.: Proline metabolism
in the conceptus: implications for fetal growth and development, Amino Acids, 35, 691–702, 2008.</mixed-citation></ref>
      <ref id="bib1.bib27"><label>27</label><mixed-citation>Wu, G., Bazer, F. W., Davis, T. A., Kim, S. W., Li, P., Marc Rhoads, J., Carey Satterfield, M., Smith, S. B., Spencer, T. E., and Yin, Y.: Arginine metabolism and
nutrition in growth, health and disease, Amino Acids, 37, 153–168, 2009.
 </mixed-citation></ref><?xmltex \hack{\newpage}?>
      <ref id="bib1.bib28"><label>28</label><mixed-citation>Zhao, G., Zhang, J. G., Shi, Y., Qin, Q., Liu, Y., Wang, B., Tian, K., Deng, S. C., Li, X., Zhu, S., Gong, Q., Niu, Y., and Wang, C. Y.: MiR-130b is a prognostic marker
and inhibits cell proliferation and invasion in pancreatic cancer through targeting STAT3, PLoS One, 8, e73803, <ext-link xlink:href="https://doi.org/10.1371/journal.pone.0073803" ext-link-type="DOI">10.1371/journal.pone.0073803</ext-link>, 2013.</mixed-citation></ref>
      <ref id="bib1.bib29"><label>29</label><mixed-citation> Zhou, Q., Li, M., Wang, X., Li, Q., Wang, T., Zhu, Q., Zhou, X., Wang, X., Gao, X., and Li, X.: Immune-related MicroRNAs are
abundant in breast milk exosomes, Int. J. Biol. Sci., 8, 118–123, 2012.</mixed-citation></ref>

  </ref-list><app-group content-type="float"><app><title/>

    </app></app-group></back>
    <!--<article-title-html>Identification and expression analysis of  <i>miR-144-5p</i> and <i>miR-130b-5p</i> in dairy cattle</article-title-html>
<abstract-html><p class="p">MicroRNAs (miRNAs) can coordinate the main pathways involved in
innate and adaptive immune responses by regulating gene expression. To
explore the resistance to mastitis in cows, <i>miR-144-5p</i> and
<i>miR-130b-5p</i> were identified in bovine mammary gland tissue and
14 potential target genes belonging to the chemokine signaling pathway,
the arginine and proline metabolism pathway and the mRNA surveillance pathway were
predicted. Subsequently, we estimated the relative expression of
<i>miR-144-5p</i> and <i>miR-130b-5p</i> in cow mammary tissues by
using stem-loop quantitative real-time polymerase chain reaction. The results
showed that the relative expression of <i>miR-144-5p</i> and
<i>miR-130b-5p</i> in the mastitis-infected mammary tissues (<i>n</i> = 5) was
significantly downregulated 0.14-fold (<i>p</i> &lt; 0. 01) and upregulated 3.34-fold (<i>p</i> &lt; 0. 01), respectively, compared to healthy tissues (<i>n</i> = 5). Our
findings reveal that <i>miR-144-5p</i> and <i>miR-130b-5p</i> may have
important roles in resistance to mastitis in dairy cattle.</p></abstract-html>
<ref-html id="bib1.bib1"><label>1</label><mixed-citation>
Acosta, J. C., O'Loghlen, A., Banito, A., Guijarro, M. V., Augert, A., Raguz, S., Fumagalli, M.,
Da Costa, M., Brown, C., Popov, N., Takatsu, Y., Melamed, J., d'Adda di Fagagna, F., Bernard, D., Hernando, E., and Gil, J.: Chemokine signaling via
the CXCR2 receptor reinforces senescence, Cell, 133, 1006–1018, 2008.
</mixed-citation></ref-html>
<ref-html id="bib1.bib2"><label>2</label><mixed-citation>
Baggiolini, M. and Loetscher, P.: Chemokines in inflammation and
immunity, Immunol. Today, 21, 418–420,
2000.
</mixed-citation></ref-html>
<ref-html id="bib1.bib3"><label>3</label><mixed-citation>
Balkwill, F.: The significance of cancer cell expression of the chemokine receptor CXCR4, Semin. Cancer Biol., 14,
171–179, 2004.
</mixed-citation></ref-html>
<ref-html id="bib1.bib4"><label>4</label><mixed-citation> Bannerman, D. D.: Pathogen-dependent induction of cytokines and other soluble inflammatory mediators during
intramammary infection of dairy cows, J. Anim. Sci., 87, 10–25, 2005.
</mixed-citation></ref-html>
<ref-html id="bib1.bib5"><label>5</label><mixed-citation> Bartel, D. P.: MicroRNAs, genomics, biogenesis, mechanism, and function, Cell, 116, 281–297, 2004.
</mixed-citation></ref-html>
<ref-html id="bib1.bib6"><label>6</label><mixed-citation> Bartel, D. P.: MicroRNAs, target recognition and regulatory functions, Cell, 136, 215–233, 2009.
</mixed-citation></ref-html>
<ref-html id="bib1.bib7"><label>7</label><mixed-citation> Berezikov, E.: Evolution of microRNA diversity and regulation in animals, Nature Rev. Genet., 12, 846–860, 2011.
</mixed-citation></ref-html>
<ref-html id="bib1.bib8"><label>8</label><mixed-citation> Charo, I. F. and Ransohoff, R. M.: The many roles of chemokines and chemokine receptors in inflammation, New
Engl. J. Med., 354, 610–621, 2006.
</mixed-citation></ref-html>
<ref-html id="bib1.bib9"><label>9</label><mixed-citation> Chen, C., Ridzon, D. A., Broomer, A. J., Zhou, Z., Lee, D. H., Nguyen, J. T., Barbisin, M., Xu, N. L., Mahuvakar, V. R., Andersen, M. R., Lao, K. Q., Livak, K. J., and Guegler, K. J.: Real-time quantification of
microRNAs by stem–loop RT–PC R, Nucleic Acids Res., 33, e179, <a href="https://doi.org/10.1093/nar/gni178" target="_blank">https://doi.org/10.1093/nar/gni178</a>, 2005.
</mixed-citation></ref-html>
<ref-html id="bib1.bib10"><label>10</label><mixed-citation>
Colangelo, T., Fucci, A., Votino, C., Sabatino, L., Pancione, M., Laudanna, C.,
Binaschi, M., Bigioni, M., Maggi, C. A., Parente, D., Forte, N., and Colantuoni, V.: MicroRNA-130b promotes tumor
development and is associated with poor prognosis in colorectal cancer, Neoplasia, 15, 1218–1231, 2013.
</mixed-citation></ref-html>
<ref-html id="bib1.bib11"><label>11</label><mixed-citation> Coussens, L. M. and Werb, Z.: Inflammation and cancer, Nature, 420, 860–867, 2002.
</mixed-citation></ref-html>
<ref-html id="bib1.bib12"><label>12</label><mixed-citation> Cullen, B. R.: Transcription and processing of human microRNA precursors, Mol. Cell, 16, 861–865, 2004.
</mixed-citation></ref-html>
<ref-html id="bib1.bib13"><label>13</label><mixed-citation>
Fu, Y. F., Du, T. T., Dong, M., Zhu, K. Y., Jing, C. B., Zhang, Y., Wang, L., Fan, H. B., Chen, Y., Jin, Y., Yue, G. P., Chen, S. J., Chen, Z., Huang, Q. H., Jing, Q., Deng, M., and Liu, T. X.: Mir-144 selectively regulates
embryonic a-hemoglobin synthesis during primitive erythropoiesis, Blood, 113, 1340–1349, 2009.
</mixed-citation></ref-html>
<ref-html id="bib1.bib14"><label>14</label><mixed-citation>
Gu, Y., Li, M., Wang, T., Liang, Y., Zhong, Z., Wang, X., Zhou, Q., Chen, L., Lang, Q., He, Z., Chen, X., Gong, J., Gao, X., Li, X., and Lv, X.: Lactation-related MicroRNA
expression profiles of porcine breast milk exosomes, PLoS One, 7, e43691, <a href="https://doi.org/10.1371/journal.pone.0043691" target="_blank">https://doi.org/10.1371/journal.pone.0043691</a>, 2012.
</mixed-citation></ref-html>
<ref-html id="bib1.bib15"><label>15</label><mixed-citation> Kim, V. N.: MicroRNA biogenesis, coordinated cropping and dicing, Nat. Rev. Mol. Cell Bio., 6, 376–385, 2005.
</mixed-citation></ref-html>
<ref-html id="bib1.bib16"><label>16</label><mixed-citation> Lapteva, N., Yang, A. G., Sanders, D. E., Strube, R. W., and Chen, S. Y.: CXCR4 knockdown by small interfering RNA
abrogates breast tumor growth in vivo, Cancer Gene Ther., 12, 84–89, 2005.
</mixed-citation></ref-html>
<ref-html id="bib1.bib17"><label>17</label><mixed-citation> Li, B. L., Lu, C., Lu, W., Yang, T. T., Qu, J., Hong, X., and Wan, X. P.: miR-130b is an EMT-related microRNA that
targets DICER1 for aggression in endometrial cancer, Med. Oncol., 30, 484–484, 2013.
</mixed-citation></ref-html>
<ref-html id="bib1.bib18"><label>18</label><mixed-citation> Li, Z. X., Wang, H. L., Chen, L., Wang, L. J., Liu, X. L., Ru, C. X., and Song, A. L.: Identification and
characterization of novel and differentially expressed microRNAs in peripheral blood from healthy and mastitis Holstein cattle
by deep sequencing, Anim. Genet., 45, 20–27, 2014a.
</mixed-citation></ref-html>
<ref-html id="bib1.bib19"><label>19</label><mixed-citation> Li, Z. X., Zhang, H. L., Song, N., Wang, H. L., Chen, L., Zhai, M. X., and Liu, X. L.: Molecular cloning,
characterization and expression of miR-15a-3p and miR-15b-3p in dairy cattle, Mol. Cell. Probe., 28, 255–258, 2014b.
</mixed-citation></ref-html>
<ref-html id="bib1.bib20"><label>20</label><mixed-citation> Livak, K. J. and Schmittgen, T. D.: Analysis of relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) method, Methods, 25, 402–408, 2001.
</mixed-citation></ref-html>
<ref-html id="bib1.bib21"><label>21</label><mixed-citation> Mellado, M., Rodríguez-Frade, J. M., Mañes, S., Martínez-A, C.: Chemokine signaling and functional
responses: The role of receptor dimerization and TK pathway activation, Annu. Rev. Immunol., 19, 397–421, 2001.
</mixed-citation></ref-html>
<ref-html id="bib1.bib22"><label>22</label><mixed-citation> Nash, D. L., Rogers, G. W., Cooper, J. B., Hargrove, G. L., and Keown, J. F.: Heritability of intramammary infections
at first parturition and relationships with sire transmitting abilities for somatic cell score, udder type traits, productive
life, and protein yield, J. Dairy Sci., 86, 2684–2695, 2003.
</mixed-citation></ref-html>
<ref-html id="bib1.bib23"><label>23</label><mixed-citation> Sangokoya, C., Telen, M. J., and Chi, J. T.: microRNA miR-144 modulates oxidative stress tolerance and associates
with anemia severity in sickle cell disease, Blood, 116, 4338–4348, 2010.
</mixed-citation></ref-html>
<ref-html id="bib1.bib24"><label>24</label><mixed-citation> Vasudevan, S., Peltz, S. W., and Wilusz, C. J.: Non-stop decay – a new mRNA surveillance pathway, Bioessays, 24,
785–788, 2002.
</mixed-citation></ref-html>
<ref-html id="bib1.bib25"><label>25</label><mixed-citation> Wagner, E. and Lykke-Andersen, J.: mRNA surveillance: the perfect persist, J. Cell Sci., 115, 3033–3038, 2002.
</mixed-citation></ref-html>
<ref-html id="bib1.bib26"><label>26</label><mixed-citation> Wu, G., Bazer, F. W., Datta, S., Johnson, G. A., Li, P., Satterfield, M. C., and Spencer, T. E.: Proline metabolism
in the conceptus: implications for fetal growth and development, Amino Acids, 35, 691–702, 2008.
</mixed-citation></ref-html>
<ref-html id="bib1.bib27"><label>27</label><mixed-citation> Wu, G., Bazer, F. W., Davis, T. A., Kim, S. W., Li, P., Marc Rhoads, J., Carey Satterfield, M., Smith, S. B., Spencer, T. E., and Yin, Y.: Arginine metabolism and
nutrition in growth, health and disease, Amino Acids, 37, 153–168, 2009.

</mixed-citation></ref-html>
<ref-html id="bib1.bib28"><label>28</label><mixed-citation>
Zhao, G., Zhang, J. G., Shi, Y., Qin, Q., Liu, Y., Wang, B., Tian, K., Deng, S. C., Li, X., Zhu, S., Gong, Q., Niu, Y., and Wang, C. Y.: MiR-130b is a prognostic marker
and inhibits cell proliferation and invasion in pancreatic cancer through targeting STAT3, PLoS One, 8, e73803, <a href="https://doi.org/10.1371/journal.pone.0073803" target="_blank">https://doi.org/10.1371/journal.pone.0073803</a>, 2013.
</mixed-citation></ref-html>
<ref-html id="bib1.bib29"><label>29</label><mixed-citation> Zhou, Q., Li, M., Wang, X., Li, Q., Wang, T., Zhu, Q., Zhou, X., Wang, X., Gao, X., and Li, X.: Immune-related MicroRNAs are
abundant in breast milk exosomes, Int. J. Biol. Sci., 8, 118–123, 2012.
</mixed-citation></ref-html>--></article>
