Visfatin, an adipokine hormone produced primarily by visceral adipose tissue
in mammals, has been identified as having a crucial role in growth and development
of skeletal muscle and lipids. In this research, the effects of two indel
loci (35 bp indel: AC_000161.1: g. 20540–20541 Ins
ACTGGAATTCTAGTTTAAAAATTGCTACTAATGAA located in intron 4; 6 bp indel:
AC_000161.1: g. 25873–25878 Del: TAAAAA located in intron 5)
of the visfatin gene on mRNA expression levels were studied by means of real-time quantitative
PCR (qPCR) in longissimus muscle and subcutaneous fat from 95 Qinchuan
cattle. Firstly, visfatin expression level in longissimus muscle of fetal cattle was
prominently greater than that in calves and adult cattle (
Visfatin, an adipokine hormone, is secreted and abundantly expressed in visceral adipose tissue in mammals (Steppan et al., 2001). Initially, it was discovered as Nampt (nicotinamide phosphoribosyltransferase), which catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, an intermediate in the biosynthesis of NAD (nicotinamide adenine dinucleotide; Magni et al., 1999). Subsequently, it was identified as PBEF (pre-B-cell colony-enhancing factor) induced by pokeweed mitogen and cycloheximide, and the PBEF can strengthen the effect of the stem cell factor and interleukin 7 in pre-B cell colony formation (Samal et al., 1994). Visfatin has been found to be widely expressed in multiple tissues and organs in mammals, including skeletal muscle and adipose tissues (Klöting and Klöting, 2005; McGlothlin et al., 2005; Chen et al., 2007). All of these studies indicated that visfatin was absolutely necessary for the individual growth and development. However, there are very few reports about bovine visfatin, particularly with regard to its role in bovine skeletal muscle and fat.
Specific primers for qPCR.
Agarose gel electrophoresis patterns of two indel loci.
In the last few years, genetic variants of the visfatin gene have been identified as molecular markers and showed significant associations with normal growth and development of animals and humans (Bailey et al., 2006; Jian et al., 2006; Blakemore et al., 2009). Among them, two indels (35 bp indel: AC_000161.1: g. 20540–20541 Ins ACTGGAATTCTAGTTTAAAAATTGCTACTAATGAA in intron 4; 6 bp indel: AC_000161.1: g. 25873–25878 Del: TAAAAA in intron 5) of the bovine visfatin gene were significantly associated with growth traits in Chinese cattle (Wang et al., 2009, 2012). Previous studies have reported that genetic variations, such as SNPs (single-nucleotide polymorphisms), indels (small insertions and deletions), and CNVs (copy number variants), may be involved in mRNA regulation (Hogg and Harries, 2014) and gene expression (Msalya et al., 2010; Xu et al., 2013), but the mechanisms caused by these mutations within the visfatin gene have not been well clarified.
Herein, given the limited information about bovine visfatin expression level and the operating principle of its sequence variations, the expression levels of the bovine visfatin gene were detected in longissimus muscle and subcutaneous fat at different growth stages. Furthermore, association analysis was performed based on the hypothesis that indels of the visfatin gene were associated with its mRNA level. Thus, the aim of this study was to examine the effect of the 35 and 6 bp indel loci on the expression levels of the visfatin gene in Qinchuan cattle.
Tissue samples, including longissimus muscle and subcutaneous fat, were
collected from 61 fetal cattle (26 female and 35 male, 90 days of
gestation), 10 male calves (newborn) and 24 adult male cattle (24 months
old). Samples were frozen in liquid nitrogen as soon as they were
separated, then stored at
In order to evaluate differences among expression level based on genotypes at two indel loci, individual genotypes should be detected firstly following Wang et al. (2009, 2012). In detail, the genotypes in the 35 bp indel locus were detected directly by means of electrophoresis of PCR products with 2.5 % agarose gel (Fig. 1a). At the 6 bp indel locus, the PCR products were digested with Dra I endonuclease, and the digested fragments were detected in 2.5 % agarose gel (Fig. 1b).
Gene-specific primers of the bovine visfatin gene and a housekeeping gene,
glyceraldehyde-3-phosphate dehydrogenase (GAPDH), chosen as a reference gene, were
designed using Primer 5.0 (Table 1) and verified with Primer-BLAST
(
The relative expression ratios were calculated as 2
Individual numbers for every genotype at two indel loci. The values in the brackets are the genotypic frequencies. A dash means that the genotype was not detected.
The genomic DNA from a total of 95 Qinchuan cattle, including 61 fetal cattle, 10 calves and 24 adult cattle, was genotyped for polymorphisms in the 35 and 6 bp indel loci of the bovine visfatin gene. Three genotypes were found in the 35 bp indel site and two were found in the 6 bp indel site. The individual numbers of every genotype at each locus are shown in Table 2. Compared to the insertion allele, the frequency of the deletion allele was higher in the 35 bp site but lower in the 6 bp site, which is in agreement with previous reports (Wang et al., 2009, 2012).
In order to investigate the effect of age on visfatin expression, mRNA levels in
longissimus muscle and subcutaneous fat among three growth stages were
compared using
Expression of the visfatin gene (mean
As can be clearly seen in Fig. 3a, the expression of the visfatin gene in longissimus muscle
among genotypes at the 35 bp indel locus suggests the same order in three different growth
stages: ins/ins > ins/del > del/del (ins/ins genotype was not detected in calves). In particular, the
heterozygous genotype of claves had higher visfatin mRNA than the homozygous
deletion genotype (
Expression of the visfatin gene (mean
On the other hand, at the 6 bp indel locus, statistical significance was not found in either
longissimus muscle or subcutaneous fat among visfatin expression
based on genotypes (
In the last few years, it has been revealed that visfatin plays an essential part in the development of skeletal muscle and adipose tissue. In order to add to the research on visfatin in cattle, in this study, the expression of the bovine visfatin gene referring to ages and genotypes of two indel loci was evaluated to reveal internal correlation of the bovine visfatin gene and its expression pattern in longissimus muscle and subcutaneous fat.
qPCR was applied to evaluate the expression level of visfatin in longissimus muscle and subcutaneous fat during three different growth stages of Qinchuan cattle. Results showed that the highest peak of visfatin mRNA in skeletal muscle appeared at the fetal stage. Previous studies have suggested that visfatin affected the expression of MRFs (myogenic regulatory factors), which are important muscle determination factors during embryonic skeletal muscle development (Braun and Gautel, 2011). Therefore, it was supposed that visfatin might have an important influence on embryonic myogenic programming, which, however, is in need of further functional studies. In addition to the findings, visfatin mRNA was transcribed more in adult cattle than calves in longissimus muscle, which is similar to what is shown in Tang et al. (2000) and Krzysik-Walker et al. (2008), who showed that visfatin level in skeletal muscle increased with age.
All DNA samples of the tested Qinchuan cattle were genotyped at the 35 and 6 bp indel loci of the bovine visfatin gene. Genotypic and allelic types and frequencies agreed with those published in previous reports (Wang et al., 2009, 2012). Next, the effect of these genotypes on mRNA expression was studied. For longissimus muscle, at the 35 bp indel locus, it has been shown that the tendency of visfatin expression was ins/ins > ins/del > del/del in fetal and adult cattle, while the calves with the ins/del genotype had higher expression than those with the del/del genotype. These results suggest that, at the 35 bp indel locus, the cattle with the insertion allele had a higher visfatin level compared to those with the deletion allele. By that analogy, at the 6 bp indel locus, the individuals with the deletion allele had a higher visfatin expression level than those with the insertion allele. Interestingly, growth traits of Qinchuan cattle, which were significantly associated with these two indel loci, presented a completely inverse order of del/del > ins/del > ins/ins and ins/ins > ins/del based on genotypes at the 35 and 6 bp indel loci, respectively (Wang et al., 2009, 2012). Therefore, it was hypothesized that visfatin might negatively regulate the development of longissimus muscle. Notably, the difference in visfatin level between ins/del and del/del was significant in longissimus muscle of calves at the 35 bp indel locus, which suggested that this locus, a potential molecular marker remarkably related to growth traits, could have a noteworthy influence on growth traits by prominently changing visfatin expression. At the 35 bp indel locus, in all stages, the cattle with the del/del genotype showed the lowest expression level in skeletal muscle, but they showed the lowest highest level in fat. At the 6 bp indel locus, visfatin expression levels in skeletal muscle and fat indicated a reverse trend based on genotpyes. Therefore, it was assumed that the function of visfatin in skeletal muscle and fat was inverse. This suggestion is in agreement with previous studies, which have indicated that visfatin can promote adipocytes differentiation, adipose synthesis and accumulation (Klöting and Klöting, 2005); however, it is associated with inhibition of skeletal myoblast differentiation (Fulco et al., 2008). It was perhaps because of visfatin being a regulator of visceral adipose tissue that no statistical significance was discovered among subcutaneous visfatin in fat expression based on genotypes.
In summary, here the effects of indel variations on visfatin expression in longissimus muscle and subcutaneous fat were reported. Results showed that the expression of visfatin in longissimus muscle and subcutaneous fat varied with age, and the 35 bp indel locus might be significantly associated with visfatin expression level in skeletal muscle. However, a larger population and more in-depth functional studies may be helpful for better understanding of bovine visfatin in skeletal muscle and fat development.
This study was supported by the National Natural Science Foundation of China (no. 31272408), the Program of National Beef Cattle Industrial Technology System (no. CARS-38), and the National 863 Program of China (no. 2013AA102505). Edited by: S. Maak Reviewed by: G. Liu and one anonymous referee