Introduction
Glycoconjugates are some simple molecules, but they are the most important
bioactive components in milk (Gopal and Gill, 2000). They protect against
pathogens by acting not only as competitive inhibitors through binding on
the epithelial surface of the intestine but also as growth promoters for
colonic bacterial flora (Newburg, 1999; Gopal and Gill, 2000; Nakano et al., 2001). A
number of studies on major components of milk have been performed; however,
less attention has been paid to minor components in milk such as
glycoconjugates (Martín-Sosa et al., 2009).
Glycosyltransferases and sugar transporters are glycosylation-related
enzymes/proteins which are important to milk oligosaccharide metabolism
(Wickramasinghe et al., 2011). Sialyltransferases are Golgi type II
transmembrane glycosyltransferases (Harduin-Lepers et al., 2005). As one
member of the sialyltransferases family, ST6 beta-galactosamide
alpha-2,6-sialyltransferase 1 (ST6GAL1) transfers sialic acid from
CMP-sialic acid to either type II (Galβ1, 4GlcNAc) free disaccharides
or the N- or O-linked oligosaccharides using an α2,6-linkage
(Maksimovic et al., 2011). Both human and bovine ST6GAL1 genes have
a coding region of 1218 nucleotides, which consists of five exons (Wang et
al., 1993; Mercier et al., 1999). Six single nucleotide polymorphisms (-106C>T, -399A>G,
-736G>A, -753A>C, -751C>T, and -736G>A) in
human ST6GAL1 gene were shown to affect transcription factor
binding, of which three (-753A>C, -751C>T, and
-736G>A) significantly affect promoter activity (Lee,
2008). Studies in human, mouse, and bovine showed that there is a trend of
increasing ST6GAL1 gene expression during lactation (Wang et al.,
1993; Mercier et al., 1999; Maksimovic et al., 2011). ST8
alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4)
is a key enzyme that catalyses the polycondensation of alpha-2,8-linked
sialic acids during polysialic acid synthesis. Two residues which can affect
the function of ST8SIA4 were identified in human. Arg82
significantly affects the ability of ST8SIA4 to polysialylate
neuropilin-2 and SynCAM 1, and Arg93 plays a key role in substrate
recognition (Harduin-Lepers et al., 1995, 2005). A study on transcriptome
profiling of bovine milk oligosaccharides metabolism genes showed a higher
level of expression of the ST8SIA4 gene in late lactation than in
transition, suggesting that the ST8SIA4 may play a vital role in
sialylated oligosaccharides metabolism during cow lactation (Wickramasinghe
et al., 2011). Solute carrier 35 (SLC35) is a family of nucleotide sugar
transporters (Ishida and Kawakita, 2004). Solute carrier family 35, member C1
(SLC35C1) plays an important role in regulation fucosylation of
glycans (Zhang et al., 2012). It transports GDP-L-fucose into the Golgi
apparatus for further modification and conjugation by
fucosyltransferases
(Ishida and Kawakita, 2004). The increased expression of SLC35C1
gene will increase the synthesis of GDP-L-fucose in milk (Wickramasinghe et
al., 2011). In addition, studies in human demonstrated that single amino acid
changed at some positions in the SLC35C1 will lead to the reduction
of transporting activity. Then, the fucosylated glycoconjugates on the
leukocyte surface will be lost, causing immunodeficiency (Gerardy-Schahn et
al., 2001; Hirschberg, 2001).
Water buffalo contributes significantly to the animal production and the
dairy industry in the tropical and subtropical countries (Singh et al., 2000;
Khan et al., 2011; Perera, 2011). It has become the second largest source of
milk supply in the world in recent years. Buffalo milk contains less water
and more fat, lactose, protein, and minerals than that of Holstein cow milk
(Vijh et al., 2008; Mahmood and Usman, 2010; Yindee et al., 2010). Compared
with the milk of other domestic animals, the levels of oligosaccharides are
much higher in buffalo milk (Bhanu et al., 2015). However, studies on the
encoding genes of the synthesis and metabolism of glycoconjugates in water
buffalo have not been reported. Since both water buffalo and cattle belong to
the family Bovidae, a large amount of genetic/genomic resources from cattle
research could serve as shortcuts for the water buffalo community to initiate
genomic science in this species (Michelizzi et al., 2010). The key genes of
bovine milk oligosaccharide metabolism identified by RNA sequencing in a
previous study will provide some candidate genes for studying
oligosaccharides in water buffalo milk (Wickramasinghe et al., 2011). Here,
we focus on three milk oligosaccharide metabolism genes, ST6GAL1,
ST8SIA4, and SLC35C1, which were identified in a previous
study (Wickramasinghe et al., 2011). The aim of the present study is to clone
the full-length coding sequences (CDSs) of buffalo ST6GAL1,
ST8SIA4, and SLC35C1 genes and further perform necessary
bioinformatics analysis and tissue expression analysis. The results will
establish a primary foundation for further understanding the biochemical
functions of these three genes in water buffalo.
Primers used for isolation of water buffalo ST6GAL1,
ST8SIA4, and SLC35C1 genes.
Gene
Primers (5′ to 3′)
Amplicon
Annealing
length (bp)
temperature (∘C)
ST6GAL1
F: CTCAGAACAGCGTGGTTTCC
1451
55
R: CACACACTCCCGTGACAACA
ST8SIA4
F: CTATGAAGAGGAGGTGAGGGAG
1255
57
R: TTTCAGGTAAGTGGTGGATGCT
SLC35C1
F: CAGGAAATCAGTCTGGCTGTGA
1494
56
R: TCAAAGGTCGTGTGGAGGTAGA
Primers used for semi-quantitative RT-PCR.
Gene
Primers (5′ to 3′)
Annealing
References
(accession no.)
temperature (∘C)
ST6GAL1
F: GGTGTGCTGTGGTCTCTTCA
60
Maksimovic et al. (2011)
R: CCCACGTCTTGTTGGAATTT
ST8SIA4
F: ACGCAACTCATCGGAGATGGTGA
60
Desanti et al. (2011)
R: GTGTCCGTCGTCTGTCCAGC
SLC35C1
F: GCATCTGGCGTCTGACCTT
61
this study
(NM_001101210)
R: CGTCTGGGCACAGGCTTT
18S rRNA
F: GGACATCTAAGGGCATCACAG
55
this study
(JN412502)
R: AATTCCGATAACGAACGAGACT
Material and methods
Sample collection, RNA extraction, and cDNA synthesis
All procedures for sample collection were performed in accordance with the
Guide for Animal Care and Use of Experimental Animals and approved by the
Institutional Animal Care and Use Committee of Yunnan Agricultural
University. Six adult female Binglangjiang water buffalo, of which three were
in non-lactating stage (the dry period) and another three were in the peak of
lactation, respectively, were selected and slaughtered for sample collecting.
The heart, pituitary gland, small intestine (the duodenum), longissimus dorsi
muscle, spleen, liver, mammary gland, dorsal skin, lung, brain, kidney,
rumen,
and back adipose tissue were collected and preserved in liquid nitrogen
immediately and then stored at -80 ∘C until further processing.
Total RNA was extracted using the RNAiso Plus kit (TaKaRa, Dalian, China)
following the manufacturer's instructions. To avoid potential DNA
contamination, the RNA was treated with DNase I (TaKaRa, Dalian, China). The
RNA quality from the different types of tissues was first assessed on a
1.5 % agarose gel electrophoresis containing ethidium bromine; then its
concentration and purity were determined using the NanoDrop 2000 UV–Vis
spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The cDNA was
synthesized from 3 µg RNA for each sample using an oligo(dT) 18
primer and M-MLV reverse transcriptase (Invitrogen, USA).
Primer design and gene isolation
Based on the mRNA sequence of cattle ST6GAL1 (accession no.
NM_001035373) and its highly homologous expressed sequence tags (accession
no. DT809938, EE365129, EV620792, EE980740, GO784097, and EE903357), which
were downloaded from the National Center for Biotechnology Information
(NCBI) database (http://www.ncbi.nlm.nih.gov/), a pair of primers were
designed using Oligo 6.0 software to amplify the full-length CDS of buffalo
ST6GAL1 gene. Similarly, the primers for isolating buffalo
ST8SIA4 and SLC35C1 genes were designed based on the
nucleotide sequences of cattle ST8SIA4 and SLC35C1 genes
and their respective homologous sequences (NM001001163, EE900497, EE965073,
EE828093, EH146320, and NM_001101210), respectively. Detailed primer
information is described in Table 1.
PCR reactions for cloning buffalo ST6GAL1, ST8SIA4, and
SLC35C1 genes were performed in a final volume of 25 µL
containing 2.0 µL of 50 ng µL-1 cDNA,
2.0 µL of 2.5 mM dNTPs mixed (TaKaRa, Dalian, China),
2.5 µL of 10× Taq DNA polymerase buffer (Mg2+ Plus),
0.5 µL of 10 µM forward primer, 0.5 µL of
10 µM reverse primer, 0.25 µL of
5 U µL-1 Ex Taq DNA polymerase (TaKaRa, Dalian, China), and
17.25 µL of sterile water. The PCR mixtures underwent 5 min at
95 ∘C followed by 35 cycles of denaturing at 95 ∘C for
30 s, annealing with different temperature according to different primers
and extension for 2 min at 72 ∘C and with a final extension cycle
of 72 ∘C for 10 min. The annealing temperatures for RT-PCR are
shown in Table 1. The amplified fragments were sub-cloned into the pMD18-T
vector (TaKaRa, Dalian, China) and then sequenced bi-directionally using an
automated DNA sequencer (ABI3730). At least eight independent clones were
sequenced.
Semi-quantitative RT-PCR
Semi-quantitative RT-PCR (reverse transcription polymerase chain reaction)
was conducted to evaluate the gene expression level of 13 tissues. Also, it
was carried out to determine the differential expression in the mammary gland
of both lactating and non-lactating stage. To eliminate the effect of cDNAs
concentration, we repeated the RT-PCR five times using 1, 2, 3, 4, and
5 µL cDNAs as templates, respectively. The housekeeping gene
18S ribosomal RNA was selected as an endogenous control for
determination of targeted mRNA relative quantity because of its stable
expression in most tissues of the body. The primers designed for the
semi-quantitative RT-PCR analysis were presented in Table 2. The PCR
conditions were as follows: 95 ∘C for 4 min followed by 30 cycles of
denaturation at 95 ∘C for 30 s, annealing at a suitable temperature
(Table 2) for 30 s, and extension at 72 ∘C for 30 s and a final
extension cycle of 72 ∘C for 5 min.
Bioinformatics analysis
The amino acid sequences of the ST6GAL1, ST8SIA4, and
SLC35C1 were deduced from the coding region via DNAStar version 7.0
(DNAStar, Inc., USA). Physicochemical characteristics, including theoretical
molecular weight and isoelectric point, hydropathy, transmembrane region,
signal peptide, and subcellular localization, were predicted using the
Compute pI/Mw tool (http://web.expasy.org/compute_pi/; Walker, 2005),
ProtParam tool (http://web.expasy.org/protparam/), ProtScale
(http://web.expasy.org/protscale/), TMHMM version 2.0
(http://www.cbs.dtu.dk/services/TMHMM/; Krogh et al., 2001), SignalP
4.1 Server (http://www.cbs.dtu.dk/services/SignalP/; Petersen et al.,
2011), and ProtComp 9.0 (http://linux1.softberry.com/berry.phtml),
respectively. The conserved domains and functional sites were analysed using
the Conserved Domain Architecture Retrieval Tool in BLAST at the NCBI server
(http://www.ncbi.nlm.nih.gov/BLAST) and SMART
(http://smart.emblheidelberg.de/). Secondary structures of deduced AA
sequences were predicted by SOPMA (http://npsa-pbil.ibcp.fr/). The
three-dimensional structure homology models of the ST6GAL1,
ST8SIA4, and SLC35C1 were constructed using Swiss-Model
(http://swissmodel.expasy.org/; Biasini et al., 2014). Multiple
sequence alignment was performed using Clustal X 2.0 (Larkin et al., 2007).
Neighbour-joining phylogenetic trees were generated based on the
ST6GAL1, ST8SIA4, and SLC35C1 sequences by applying
MEGA version 6.0 (Tamura et al., 2013), which were subsequently subjected to
be edited manually. Statistical reliability of the groups within phylogenetic
trees was assessed using the bootstrap method with 10 000 replications.
Results
RT-PCR results for buffalo <italic>ST6GAL1</italic>, <italic>ST8SIA4</italic>, and <italic>SLC35C1</italic> genes
RT-PCR was adopted to amplify the full-length CDSs of buffalo
ST6GAL1, ST8SIA4, and SLC35C1 genes using the
cDNAs as templates. The resulting PCR products were 1451, 1255, and 1494 bp,
respectively (Fig. S1 in the Supplement).
Sequence analysis and genetic relationships
Sequence prediction showed that the cDNA sequences from this study in turn
contained an open-reading frame of 1218, 1080, and 1095 bp, respectively. The
nucleotide sequence analysis using the BLAST programme at the NCBI server
(http://www.ncbi.nlm.nih.gov/) displayed that the gene sequences
acquired were not homologous to any of the known water buffalo genes. Then
the cDNA sequences of this study were deposited into the GenBank database
under accession number KF360006, JX891653, and JX888717. The CDS
of buffalo ST6GAL1 has an overall base composition of 26.11 % A,
27.5 % C, 24.3 % G, and 22.09 % T, and that of buffalo
ST8SIA4 has a composition of 29.81 % A, 19.81 % C,
23.52 % G, and 26.85 % T. The SLC35C1 CDS has a composition
of 17.63 % A, 32.6 % C, 27.85 % G, and 21.92 % T.
Sequence alignment analysis between water buffalo and other common
vertebrates was performed based on the ST6GAL1, ST8SIA4,
and SLC35C1 sequences of this study and that published in the
GenBank (http://www.ncbi.nlm.nih.gov/) (Fig. S2). Multiple alignment
revealed that the amino acid sequences of buffalo ST6GAL1,
ST8SIA4, and SLC35C1 had high homology with previously
reported gene sequences in other species. Buffalo ST6GAL1 sequence
has 97.6–98.5 % similarity with its homologous sequences of the species
in the family Bovidae and has 74.3–82.9 % similarity with other
mammalian species (Fig. S2a). Buffalo ST8SIA4 sequence shows
98.6–99.7 % homology with the species in the Bovidae and shows
93.3–99.7 % homology with other vertebrate species (Fig. S2b). However, the
sequence of buffalo SLC35C1 shares 97.8–99.2 % similarity with
its homologous sequences of the species in the Bovidae, and shares
86.3–99.2 % similarity with other mammalian species (Fig. S2c). In order
to gain a better understanding of the genetic relationships of buffalo
ST6GAL1, ST8SIA4, and SLC35C1 genes to that of
other species, phylogenetic trees are constructed on the basis of the CDSs of
these three genes by the neighbour-joining method (Fig. 1). The
ST6GAL1, ST8SIA4, and SLC35C1 CDSs of water
buffalo and other bovine species formed a sub-group in the corresponding
trees with high support, which indicates that the three buffalo genes had a
higher sequence identity with cattle, yak, and bison than with other species
(Fig. 1).
Phylogenetic analyses based on the CDSs of the three genes between
buffalo and other species. (a) ST6GAL1,
(b) ST8SIA4, and (c) SLC35C1.
![]()
Transmembrane regions of buffalo ST6GAL1 (a),
ST8SIA4 (b), and SLC35C1 (c) predicted by
TMHMM programme.
![]()
Characteristics and structures of ST6GAL1, ST8SIA4, and
SLC35C1 proteins
Buffalo ST6GAL1 includes 405 amino acids with a predicted molecular
weight (MW) of ∼ 46.27 kDa and a theoretical pI of 9.04. Buffalo
ST8SIA4 is 359 amino acids long and has a MW of about 41.29 kDa and
a theoretical pI of 9.73. The SLC35C1 contains 364 amino acids with
a predicted MW of about 40.11 kDa and a theoretical pI of 8.78. Both the
ST6GAL1 and ST8SIA4 were classified as an unstable protein,
with an instability index (II) of 41.12 for the ST6GAL1 and that of
47.36 for the ST8SIA4. The SLC35C1 was classified as a
stable protein (instability index (II) = 33.75). Comparison of buffalo
ST6GAL1, ST8SIA4, and SLC35C1 amino acid sequences
with the sequences previously published in some representative species showed
that the buffalo proteins all contained one conserved functional domain. The
conserved domains of the ST6GAL1, ST8SIA4, and
SLC35C1 are displayed in Fig. S3. Both buffalo ST6GAL1 and
ST8SIA4 have a Glyco_transf_29 domain (aa 149–383 for the
ST6GAL1, aa 94–354 for the ST8SIA4), which indicates these
two proteins belong to glycosyltransferase family 29. However, the
SLC35C1 contains a TPT domain (aa 39–338) that is found in a number
of sugar phosphate transporters, including those with a specificity for
triose phosphate. One transmembrane region (aa 9–27) was predicted in the
ST6GAL1 (Fig. 2a). No transmembrane region was predicted in the
ST8SIA4 (Fig. 2b), and eight transmembrane regions were predicted in
the SLC35C1 (aa 36–58, aa 73–95, aa 116–135, aa 139–161, aa
168–185, aa 195–214, aa 227–249, and aa 264–286) (Fig. 2c). There were
five, five and three kinds of functional sites predicted in buffalo
ST6GAL1, ST8SIA4, and SLC35C1 proteins,
respectively (Table S1). Cytplasmic–nuclear discrimination suggested that
both buffalo ST6GAL1 and ST8SIA4 are possibly located in
the Golgi apparatus with more than 98 % reliability, and buffalo
SLC35C1 functions in membrane bound the Golgi. A putative N-terminal
signal peptide was predicted in buffalo ST8SIA4, and its most likely
peptide cleavage sites are between the 26th and 27th amino acids. However, no
N-terminal signal peptide has been predicted in the amino acid sequences of
both buffalo ST6GAL1 and SLC35C1. Hydropathy analysis
showed that the grand averages of hydropathicity (GRAVY) for buffalo
ST6GAL1, ST8SIA4, and SLC35C1 were -0.362,
-0.247, and 0.493, respectively, which suggested that both buffalo
ST6GAL1 and ST8SIA4 were hydrophilicity proteins, whereas
buffalo SLC35C1 was a hydrophobin.
Prediction of secondary structure indicated that the deduced buffalo
ST6GAL1 contains 32.35 % α-helix, 15.56 % extended
strand, 3.70 % β-turn ,and 48.39 % random coil. The
ST8SIA4 is composed of 37.88 % α-helix, 18.38 %
extended strand, 5.57 % β-turn, and 38.17 % random coil. The
SLC35C1 consists of 44.23 % α-helix, 24.45 %
extended strand, and 2.20 % β-turn, and 29.12 % random coil
(Fig. 3). The three-dimensional structure homology models of both buffalo
ST6GAL1 and ST8SIA4 were built based on the target-template
alignments (Fig. 3). The results showed that buffalo ST6GAL1 was
similar to human beta-galactoside alpha-2,6-sialyltransferase 1 with
87.70 % identity and 78 % coverage, and buffalo ST8SIA4 was
similar to the structure of human alpha 2,8-sialyltransferase with
38.14 % identity and 87 % coverage (Fig. 3). Buffalo SLC35C1
was unable to build a model since raw model contained fewer than three amino acid
residues.
Tissue expression analysis
Tissue expression profiles of the ST6GAL1, ST8SIA4, and
SLC35C1 genes were assayed via semi RT-PCR in 13 tissues of
lactating buffalo. The results demonstrated that the relative expression
levels of the buffalo ST6GAL1 gene were high in the pituitary gland;
moderate in the spleen, liver, mammary gland, brain, and kidney; and weak in the
small intestine, lung, and rumen, and there was no expression in the heart,
longissimus dorsi muscle, dorsal skin, and back adipose tissues. Buffalo
ST8SIA4 gene was predominantly expressed in the longissimus dorsi
muscle, moderately expressed in the pituitary gland, spleen, liver, mammary
gland and lung, weakly expressed in brain, kidney and rumen, and minimally
expressed in the heart, small intestine, dorsal skin and back adipose tissue.
The SLC35C1 gene exhibited highest expression level in the pituitary
gland; moderate in the longissimus dorsi muscle, spleen, liver, mammary
gland, lung, brain, kidney, and rumen; weak in the heart and small intestine;
and minimal expression in the dorsal skin and back adipose tissue (Fig. 4a
and c).
The expression pattern of buffalo ST6GAL1, ST8SIA4, and
SLC35C1 genes in the mammary tissues of lactating and non-lactating
buffalo was analysed in the present study. Remarkable differences of the
ST6GAL1, ST8SIA4, and SLC35C1 mRNA expressions
between the lactating and non-lactating period were observed in the mammary
gland of water buffalo. These three genes showed higher expression levels in
lactating than in non-lactating period. The expression levels of water
buffalo STGAL1, ST8SIA4, and SLC35C1 genes showed
a significant difference between lactating stage and non-lactating stage
(Fig. 4b). Their expression levels in lactating stage were 2.28, 1.30, and
1.69 times that of non-lactating stage, respectively (Fig. 4b).
Predicted secondary structures of buffalo
ST6GAL1 (a), ST8SIA4 (b), and
SLC35C1 (c), and tertiary structures of buffalo
ST6GAL1 (d) and ST8SIA4 (e). Alpha helix,
extended strand, beta turn, and random coil are indicated with the longest,
second longest, third longest, and shortest vertical lines, respectively.
![]()
Expression analysis of buffalo ST6GAL1, ST8SIA4,
and SLC35C1 genes. Results are expressed as the ratio between the
intensity of bands corresponding to the gene studied vs. the intensity of
bands corresponding to 18S rRNA internal control. The vertical axis
represents gene relative quantification (mean ± SE) estimated from
three biological replicates, and the horizontal axis indicates different
tissues. Error bars represent the standard deviation of three samples.
(a) Tissue expression profiles of buffalo ST6GAL1,
ST8SIA4, and SLC35C1 genes in the 13 tissues of lactating
buffalo. (b) Differential expression of the reference gene
18S rRNA, and buffalo ST6GAL1, ST8SIA4,
SLC35C1 genes in the mammary gland of lactating and non-lactating
stage. Each lane in the gel image is corresponding to the bar of the bar
chart. (c) Relative expression levels of buffalo ST6GAL1,
ST8SIA4, and SLC35C1 genes in the 13 tissues of lactating
buffalo. Note: 1 – heart, 2 – pituitary gland, 3 – small intestine, 4 –
longissimus dorsi muscle, 5 – spleen, 6 – liver, 7 – mammary gland, 8 –
dorsal skin, 9 – lung, 10 – brain, 11 – kidney, 12 – back adipose tissue,
13 – rumen. 14, 16, 18, and 20 respectively represent the expressions of
buffalo 18S rRNA, ST6GAL1, ST8SIA4, and
SLC35C1 genes in lactating mammary gland, while 15, 17, 19, and 21
denote the corresponding expressions of these four buffalo genes in
non-lactating mammary gland.
![]()
Discussion
As more and more genomes are sequenced, comparative genomics offers new
insights into the structural and functional characteristics of genes through
comparison of individual gene sequences between different species (Ellegren,
2008). Comparative genomic-based strategies have begun to aid in the
identification of functional sequences based on their high level of
evolutionary conservation (Nobrega and Pennacchio, 2004). Sequence similarity
information among the genomes of different species has become a major
resource for cloning new genes, finding functional regions, and predicting
functions, especially for improvement in identification of protein-coding
genes in closely related species (Hardison, 2003). This extensive
conservation in protein-coding regions between diverse species in mammals
will provide us with a powerful approach to identify the functional regions
of different genes for water buffalo. Water buffalo and cattle are the
members of the family Bovidae, they have been shown to be closely related,
and their chromosomes can be matched arm to arm at the cytogenetic level
(Amaral et al., 2008). Compared with other common domestic animals, at
present the studies on buffalo genome have lagged behind relatively. Taking
advantage of the extensive resources and data now being accessible from the
cattle-related studies, we can easily study water buffalo protein-coding
genes through comparision with that of cattle.
Glycoconjugates are some of the most important bioactive components in milk,
but little or no attention has been paid to these minor components in milk
(Martín-Sosa et al., 2009). Previous studies have shown that
ST6GAL1, ST8SIA4, and SLC35C1 genes play important
roles in the synthesis of glycoconjugates (Hamamoto and Tsuji, 2002;
Hellbusch, 2007; Yang et al., 2012). In the present study, the complete CDSs
of buffalo ST6GAL1, ST8SIA4, and SLC35C1 genes
were firstly isolated from buffalo cDNAs based on their counterpart sequence
information of cattle and other species, and the CDSs of these three genes
and their encoding proteins were characterized by adopting the method of
comparative genomics. The CDSs of buffalo ST6GAL1, ST8SIA4,
and SLC35C1 are 1218, 1080, and 1095 nucleotides in length, which
encode a protein containing 405, 359, and 364 amino acids, respectively.
Sequence analysis showed that buffalo ST6GAL1, ST8SIA4, and
SLC35C1 had high identity at the amino acid level with other
animals, especially with bovine species, confirming that the genes were
isolated from the correction. In addition, genetic relationships based on
buffalo ST6GAL1, ST8SIA4, and SLC35C1 genes
revealed that water buffalo had a closer relationship with bovine species
than with other species. These results indicate that buffalo
ST6GAL1, ST8SIA4, and SLC35C1 have a similar
function as that of bovine species. Our results also showed that the method
of comparative genomics is extremely effectual to identify novel genes and to
predict probable functions for the novel genes.
Previous studies in some vertebrates revealed that both ST6GAL1 and
ST8SIA4 predominantly reside in the Golgi compartment where
ST6GAL1 serves as a sialyltransferase transferring sialic acid from
CMP-sialic acid to type II free disaccharides or the termini of N- or O-linked
oligosaccharides (Maksimovic et al., 2011), and ST8SIA4 as a
polysialyltransferase responsible for the polysialylation of the neural cell
adhesion molecule (Close et al., 2000). They all are a member of
glycosyltransferase family 29 (Harduin-Lepers et al., 2005; Foley et al.,
2009). The SLC35C1 protein is a type III membrane protein which
transports nucleotide sugars pooled in the cytosol into the lumen of Golgi
apparatus, where most glycoconjugate synthesis occurs (Ishida and Kawakita,
2004). In the present study, a same function domain, Glyco_transf_29
domain, was predicted in both buffalo ST6GAL1 and ST8SIA4,
suggesting they belong to the glycosyltransferase family 29. Both buffalo
ST6GAL1 and ST8SIA4 are classified as hydrophilicity
proteins and predicted possibly to function in the Golgi apparatus. A
transmembrane domain of 19 amino acids (aa 9–27) was predicted in buffalo
ST6GAL1, which is consistent with the observation in bovine (Mercier
et al., 1999). Buffalo SLC35C1 was presumed as a hydrophobic protein
existing in the Golgi membrane. A prior study showed that SLC35C1
was a protein with 10 transmembrane domains (Ishida and Kawakita, 2004).
However, there were only eight transmembrane regions predicted in the
present study. These results confirm the functional similarity for buffalo
ST6GAL1, ST8SIA4, and SLC35C1 to that of other
vertebrates. Protein analysis showed that all of these three proteins contain
numerous putative sites, such as protein kinase C phosphorylation site,
N-myristoylation site, casein kinase II phosphorylation site, tyrosine kinase
phosphorylation site, and cAMP- and cGMP-dependent protein kinase
phosphorylation site. Most protein functions are regulated by the
modification of some amino acids in the polypeptide chain. Whether these
putative functional sites play crucial roles in their corresponding
protein remains a further investigation.
The tissue expression profile showed that these three genes were obviously
differentially expressed in different tissues of the lactating buffalo. A
possible explanation for the results is that at the same stage of development
those biological activities associated with the function of the
ST6GAL1, ST8SIA4, and SLC35C1 were presented in a
wide range between different tissues within an individual organism. Tissue
expression analysis in a dairy cow which was slaughtered 34 days following
birth indicated that the expression level of the ST6GAL1 mRNA in the
liver was significantly higher than in any other tissues examined (Maksimovic
et al., 2011). According to the EST profiles of cattle in UniGene
(ST8SIA4,
http://www.ncbi.nlm.nih.gov/UniGene/ESTProfileViewer.cgi?uglist=Bt.17789
and SLC35C1,
http://www.ncbi.nlm.nih.gov/UniGene/ESTProfileViewer.cgi?uglist=Bt.27334),
the ST8SIA4 and SLC35C1 showed the highest expression level
in the kidney and intestine, respectively. However, our results showed that
buffalo ST6GAL1 and SLC35C1 mRNAs were expressed more
abundantly in the pituitary gland, whereas the ST8SIA4 mRNA was
expressed more abundantly in the longissimus dorsi muscle than in other
tissues, suggesting that the genes play particularly key roles in water
buffalo pituitary gland or longissimus dorsi muscle. The expressions of these
three genes seem to display different patterns in water buffalo with cattle,
and the reasons for these differences still need further investigation.
The expression of some lipogenic genes was detected in lactating and
non-lactating mammary tissue of buffalo by semi-quantitative RT-PCR method
(Yadav et al., 2012). In the current study, the expressions of buffalo
ST6GAL1, ST8SIA4, and SLC35C1 genes were compared
in the mammary gland of both lactating and non-lactating stages using the
same strategy. The results showed that buffalo ST6GAL1,
ST8SIA4, and SLC35C1 genes were moderately expressed in
lactating stage. Furthermore, the three buffalo genes manifested higher
expression in the lactating than in the non-lactating stage, which is consistent
with the observation in cattle (Wickramasinghe et al., 2011). This implies
that these buffalo genes may participate in some biological processes during
lactation.
Progress in lactation biology of the bovine mammary has advanced
substantially in recent years (Bauman et al., 2006). The knowledge of
lactation biology and biosynthesis of milk will be used further for exploring
the genes controlling the milk yield and composition in dairy animals for the
improvement in quality and quantity of dairy products. Key roles have been
attributed to water buffalo in providing milk in many developing countries in
Asia, especially in tropical and subtropical countries (Perera, 2011).
However, due to limited prior genomic characterization, the genetic
improvement of water buffalo has lagged behind other bovine species (Amaral
et al., 2008). With the promotion of consumer awareness of the links between
diet and health, nutrition quality of milk is becoming increasingly important
in food choice. Identification of the key genes involved in milk
glycoconjugate synthesis was essential for improving milk quality in water
buffalo.